Copy Link Print Information

hsa-miR-3133 antagomir

hsa-miR-3133 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

연구목적의 판매만을 진행합니다. 환자를 대상으로 한 판매는 하지 않습니다.

  • 분자량:7347.68
  • 보관:

    Please store the product under the recommended conditions in the Certificate of Analysis.

  • hsa-miR-3133 antagomir Chemical Structure
    hsa-miR-3133 antagomir Chemical Structure
사이즈
가격
재고
수량
Amount: USD 0.00
Please select quantity
or
or

* 장바구니에 담기 전 물품의 수량을 선택해 주십시오.

To place orders, for customer services and technical support, please contact: MedChemExpress USA

Tel: 609-228-6898 E-mail: [email protected] [email protected]

Data Download
Other Forms of hsa-miR-3133 antagomir:

To place orders, for customer services and technical support, please contact:

609-228-6898
[email protected] [email protected]
주변의 대리점 찾기 Your local distributor: Hycultec GmbHHycultec
  • Biological Activity
  • Chemical Information
  • 순도&문서
  • Help & FAQs
Top Publications Citing

Use of MCE Products
Keywords
MOQ
Minimum order quantity
100 mg

견적 받기 해외재고보유

Other size
견적 받기
Please select quantity
Amount: USD 0.00
Sign in to MedChemExpress 로그인
Register
Sign in to MedChemExpress
회원가입

At least 6 characters

Personalize your experience, you are currently not signed in. For a better experience, please create an online profile, you can:

Obtain points redemption prizes
Check out faster
Add multiple shipping locations
View orders
Assay Types
  • hsa-miR-3133 antagomir Chemical Structure
    hsa-miR-3133 antagomir Chemical Structure RNA, (AUUGGGUUUUAAGAGUUCUU) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)
    1/16
  • RNA, (AUUGGGUUUUAAGAGUUCUU) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)