hsa-miR-3668 antagomir

Art. -Nr.: HY-RI00778A: Data Sheet Handling Instructions
FAQs
Technical Support

hsa-miR-3668 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Nur für Forschungszwecke. Wir verkaufen nicht an Patienten.

RNA, (AUUUUGAUCAAUCUCUACA) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-3668 antagomir Chemische Struktur

Größe	Preis	Verfügbarkeit	Menge
5 nmol		Angebot einholen 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31
20 nmol		Angebot einholen 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or Massenanfrage

* Bitte wählen Sie Menge, bevor Sie Artikel hinzufügen.

This product is a controlled substance and not for sale in your territory.

Kundenbewertung

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-3668 antagomir:

hsa-miR-3668 inhibitor Angebot einholen

Spezialitätsempfehlungen

•Related Small Molecules:

•Related Proteins:

Biologische Aktivität
Reinheit & Dokumentation
Kundenbewertung

Beschreibung	hsa-miR-3668 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Molekulargewicht	6914.45
miRBase Accession Number	MI0016069
Mature miRNA Sequence	AAUGUAGAGAUUGAUCAAAAU
Stem-loop ID	hsa-mir-3668
Stem-loop Sequence	AUAUAUGAAAUGUAGAGAUUGAUCAAAAUAGUUUCUAUCAAAAUAGUUUUGAUCAAUCUCUGCAAUUUUAUAUAU
Species	Human
Versand	Room temperature in continental US; may vary elsewhere.
Speicherung	Please store the product under the recommended conditions in the Certificate of Analysis.
Reinheit & Dokumentation	Data Sheet (229 KB) Handling Instructions (2659 KB)