hsa-miR-606 agomir

Cat. No.: HY-R01840A: Ficha de datos Instrucciones de manejo
FAQs
Technical Support

hsa-miR-606 agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Para uso exclusivo en investigación. No vendemos a pacientes.

RNA, (AAACUACUGAAAAUCAAAGAU), complex with RNA, (CUUUGAUUUUCAGUAGUUUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-606 agomir Estructura química

Tamaño	Precio	Stock	Cantidad
5 nmol		Obtener un presupuesto 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31
20 nmol		Obtener un presupuesto 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or Consulta para venta a granel

* Seleccione Cantidad antes de agregar artículos.

This product is a controlled substance and not for sale in your territory.

Revisión del cliente

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-606 agomir:

hsa-miR-606 mimic Obtener un presupuesto

Recomendaciones destacadas

•Related Small Molecules:

•Related Proteins:

Actividad biológica
Pureza y Documentación
Revisión del cliente

Descripciòn	hsa-miR-606 agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Peso molecular	14417.94
miRBase Accession Number	MI0003619
Mature miRNA Sequence	AAACUACUGAAAAUCAAAGAU
Stem-loop ID	hsa-mir-606
Stem-loop Sequence	UGUAUCCUUGGUUUUUAGUAGUUUUACUAUGAUGAGGUGUGCCAUCCACCCCAUCAUAGUAAACUACUGAAAAUCAAAGAUACAAGUGCCUGACCA
Species	Human
Envío	Room temperature in continental US; may vary elsewhere.
Almacenamiento	Please store the product under the recommended conditions in the Certificate of Analysis.
Pureza y Documentación	Ficha de datos (229 KB) Instrucciones de manejo (2659 KB)