hsa-miR-6844 antagomir

Cat. No.: HY-RI02251A: Ficha de datos Instrucciones de manejo
FAQs
Technical Support

hsa-miR-6844 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Para uso exclusivo en investigación. No vendemos a pacientes.

RNA, (CUGUGAAUUAAAAACAAAG) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-6844 antagomir Estructura química

Tamaño	Precio	Stock	Cantidad
5 nmol		Obtener un presupuesto 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31
20 nmol		Obtener un presupuesto 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or Consulta para venta a granel

* Seleccione Cantidad antes de agregar artículos.

This product is a controlled substance and not for sale in your territory.

Revisión del cliente

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-6844 antagomir:

hsa-miR-6844 inhibitor Obtener un presupuesto

Recomendaciones destacadas

•Related Small Molecules:

•Related Proteins:

Actividad biológica
Pureza y Documentación
Revisión del cliente

Descripciòn	hsa-miR-6844 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Peso molecular	7086.66
miRBase Accession Number	MI0022690
Mature miRNA Sequence	UUCUUUGUUUUUAAUUCACAG
Stem-loop ID	hsa-mir-6844
Stem-loop Sequence	GAACUUAAGAAUUUUGUAGAAAUCAAGCUAUUUGCUAAAAGUUCUUUGUUUUUAAUUCACAG
Species	Human
Envío	Room temperature in continental US; may vary elsewhere.
Almacenamiento	Please store the product under the recommended conditions in the Certificate of Analysis.
Pureza y Documentación	Ficha de datos (229 KB) Instrucciones de manejo (2659 KB)