Copy Link Print Information

mmu-miR-130b-5p agomir

Kundenbewertung

Based on 1 Customer Validation

mmu-miR-130b-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Nur für Forschungszwecke. Wir verkaufen nicht an Patienten.

  • Molecular Weight:15103.37
  • Speicherung:

    Please store the product under the recommended conditions in the Certificate of Analysis.

  • mmu-miR-130b-5p agomir Chemical Structure
    mmu-miR-130b-5p agomir Chemical Structure
Größe
Preis
Verfügbarkeit
Menge
Amount: USD 0.00
Please select quantity
or
or

* Bitte wählen Sie Menge, bevor Sie Artikel hinzufügen.

To place orders, for customer services and technical support, please contact: MedChemExpress USA

Tel: 609-228-6898 E-mail: [email protected] [email protected]

Data Download
Other Forms of mmu-miR-130b-5p agomir:

To place orders, for customer services and technical support, please contact:

609-228-6898
[email protected] [email protected]
Finden Sie Ihren Händler vor Ort Your local distributor: Hycultec GmbHHycultec
  • Biologische Aktivität
  • Chemical Information
  • Reinheit & Dokumentation
  • Help & FAQs
Top Publications Citing

Use of MCE Products

Keywords

MOQ
Minimum order quantity
100 mg

Angebot einholen Auf Lager

Other size
Angebot einholen
Please select quantity
Amount: USD 0.00
Sign in to MedChemExpress Einloggen
Registrieren
Sign in to MedChemExpress
Neuen Account Registrieren

At least 6 characters

Personalize your experience, you are currently not signed in. For a better experience, please create an online profile, you can:

Obtain points redemption prizes
Check out faster
Add multiple shipping locations
View orders
Assay Types
  • mmu-miR-130b-5p agomir Chemical Structure
    mmu-miR-130b-5p agomir Chemical Structure RNA, (ACUCUUUCCCUGUUGCACUACU), complex with RNA, (UAGUGCAACAGGGAAAGAGUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)
    1/16
  • RNA, (ACUCUUUCCCUGUUGCACUACU), complex with RNA, (UAGUGCAACAGGGAAAGAGUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)