P-SETDB1-4 

P-SETDB1-4 is a SETDB1 PROTAC degrader with a K_d of 86 nM. P-SETDB1-4 recruits CRBN to SETDB1, induces proteasome-dependent degradation of SETDB1, and forms a ternary complex with CRBN to achieve targeted degradation. P-SETDB1-4 reduces DNA synthesis. P-SETDB1-4 exhibits anticancer activity against breast cancer. P-SETDB1-4 can be used in breast cancer-related research^[1]. (Pink: SETDB1 Target protein ligand; Blue: Cereblon ligand (HY-W942093); Black: linker).

P-SETDB1-4 (5 μM; 24-96 h) exhibits good serum stability, with ~40% of the reagent remaining intact after 24 h incubation in 20% fresh serum^[1].
P-SETDB1-4 (100 μM) binds purified SETDB1 TTDs with high affinity, exhibiting a K_d of 86 nM^[1].
P-SETDB1-4 specifically binds endogenous SETDB1 and CRBN in MCF-7 cell lysates^[1].
P-SETDB1-4 (62.5 nM-1000 nM; 2-24 h) induces CRBN- and proteasome-dependent, post-translational degradation of SETDB1 in MCF-7 and T47D breast cancer cells, with substantial degradation observed at 12 h and dose-dependent effects at concentrations ≥500 nM after 24 h^[1].
P-SETDB1-4 (1 μM; 24-96 h) significantly reduces the viability of MCF-7 and T47D breast cancer cells after 24-96 h of incubation^[1].
P-SETDB1-4 (1 μM; 24 h) decreases DNA synthesis in MCF-7 and T47D breast cancer cells, as shown by reduced EdU-positive cell percentages after 24 h of incubation^[1].
P-SETDB1-4 treatment activates the transcriptome and transposable elements (predominantly LTR-type) in MCF-7 breast cancer cells, upregulating genes involved in focal adhesion, cancer pathways, and p53 signaling, including a 2.1-fold increase in CDKN1A and 1.6-fold increase in SNAIL1^[1].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

Liposome-encapsulated P-SETDB1-4 (5 mg/kg; peritumoral injection; on days 10, 12, 14, 15, 16, 17 post-tumor cell injection) significantly inhibits breast cancer xenograft growth in BALB/c nude mice, reduces tumor-associated SETDB1 and Ki-67 levels, and shows no detectable systemic toxicity^[1].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

594.64

C₂₉H₃₆N₇O₇

O=C1N(C2CCC(NC2=O)=O)C(C3=C(OCC(NCC4=CN(CCCC(NCCCCCCC[GTTTTGCCGCATAGGATTTTTGGTTGGTCTGGTTGG])=O)N=N4)=O)C=CC=C31)=O

Room temperature in continental US; may vary elsewhere.

Please store the product under the recommended conditions in the Certificate of Analysis.

• [1]. Huang S, et al. Targeted degradation of SETDB1 by an Aptamer-CRBNL PROTAC as a novel therapeutic strategy for breast cancer. European journal of medicinal chemistry. 2026 Oct 05;315:118982.