Search Result

Results for "

HBV,

" in MedChemExpress (MCE) Product Catalog:

By Targets:	HBV (288) Adenosine Receptor (1) Akt (12) Antibiotic (1) Apoptosis (12) Atg8/LC3 (2) ATM/ATR (1) Autophagy (6) Bacterial (8) Bcl-2 Family (4) Calcium Channel (8) Carbonic Anhydrase (2) Carboxylesterase (CES) (1) Caspase (2) CCR (1) CDK (3) CMV (1) Cytochrome P450 (4) Dengue Virus (1) DNA/RNA Synthesis (24) Drug Derivative (3) Drug Intermediate (2) EBV (1) Endogenous Metabolite (13) Environmental Pollutants (2) ERK (2) Estrogen Receptor/ERR (2) Exosomes (1) Ferroptosis (10) Flavivirus (1) Fungal (2) FXR (1) HCV (12) HIF/HIF Prolyl-Hydroxylase (2) Histamine Receptor (8) HIV (34) HSV (5) IFNAR (4) IKK (2) Influenza Virus (6) Interleukin Related (3) Isotope-Labeled Compounds (14) JAK (2) JNK (4) NF-κB (2) NOD-like Receptor (NLR) (2) Nucleoside Antimetabolite/Analog (6) Organoid (2) Orthopoxvirus (4) P-glycoprotein (2) p38 MAPK (2) p62 (2) Parasite (4) PD-1/PD-L1 (2) PI3K (10) PKC (2) Potassium Channel (1) PROTACs (2) Pyroptosis (2) Quinone Reductase (1) Reactive Oxygen Species (ROS) (14) Reference Standards (35) Reverse Transcriptase (17) RSV (1) SARS-CoV (5) SGLT (1) Sirtuin (7) Small Interfering RNA (siRNA) (2) STAT (3) STING (1) Tau Protein (1) Toll-like Receptor (TLR) (5) VZV (3)
By Research Areas:	Cancer (46) Cardiovascular Disease (7) Endocrinology (8) Infection (277) Inflammation/Immunology (51) Metabolic Disease (14) Neurological Disease (18)
Click Chemistry:	Azide (4) Alkynes (1)
Oligonucleotides:	Adenosine (2) Guanosine (1) Nucleoside Analogs (8) Phospholipids (1) Thymidine (1) siRNA drugs (9) Antisense Oligonucleotides (2) Cytidine (4) siRNAs (9)

312

Inhibitors & Agonists

Screening Libraries

Fluorescent Dyes

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

Natural
Products

Recombinant Proteins

Isotope-Labeled Compounds

Antibodies

Click Chemistry

Oligonucleotides

GMP Molecules

Targets Recommended: HBV

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-P3465

Bulevirtide 5+ Cited Publications Myrcludex B	HBV	Infection
Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research .

HY-117650A

RG7834 5+ Cited Publications RO 7020322; (S)-RO0321	HBV	Infection
RG7834 (RO 7020322) is a highly selective and orally bioavailable *HBV* inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC₅₀s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells .

HY-109168

Bersacapavir 2 Publications Verification JNJ-6379; JNJ-56136379	HBV DNA/RNA Synthesis	Infection
Bersacapavir (JNJ-6379) is an *HBV* capsid assembly modulator. Bersacapavir exerts a dual mechanism of action against both early and late stages of *HBV* infection by forming complete genome-free empty capsids and inhibiting de novo synthesis of cccDNA. Bersacapavir inhibits *HBV* replication. Bersacapavir can be used in the research of hepatitis B .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all *HBV* messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all *HBV* messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-177022

ALG-001075	HBV	Infection
ALG-001075, a capsid assembly modulator (CAM), is an orally active *HBV* inhibitor. ALG-001075 effectively blocks not only *HBV* DNA production but also extracellular HBsAg/HBeAg and intracellular *HBV* RNA in primary human hepatocytes. ALG-001075 shows pronounced reductions of circulating HBV DNA in the AAV-HBV mouse model. ALG-001075 can be used for the study of Chronic hepatitis B (CHB) .

HY-147255

Canocapavir ZM-H1505R	HBV	Infection
Canocapavir (ZM-H1505R) is an orally active *HBV* core protein-targeting antiviral agent. Canocapavir binds to the hydrophobic pocket at the dimer-dimer interface of HBV core protein (HBc), stimulating intracellular accumulation of nonfunctional HBV capsids, disrupting viral replication. Canocapavir interferes with the interaction between HBc and HBV large surface protein, resulting in diminished production of empty virionsis. Canocapavir can be used for the research of hepatitis B virus (HBV) infection .

HY-124600

NVR 3-778 3 Publications Verification	HBV	Infection
NVR 3-778 is a first-in-Class and oral bioavailable HBV CAM (capsid assembly modulator) belonging to the SBA (sulfamoylbenzamide) class, with anti-HBV activity .

HY-B1826

Adefovir 2 Publications Verification GS-0393; PMEA	HBV Reverse Transcriptase	Infection
Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits *HBV* DNA polymerase. Adefovir has an IC₅₀ of 0.7 μM against *HBV* in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including *HBV* and herpesviruses .

HY-P990015

Tobevibart VIR-3434	HBV	Infection
Tobevibart (VIR-3434) is a human IgG1 lambda monoclonal antibody against hepatitis B virus (HBV) surface antigen (HBsAg). Tobevibart shows potent neutralization against HBsAg from all HBV genotypes in vitro and inhibits viral entry of HBV and hepatitis delta virus (HDV). Recommend Isotype Controls: Human IgG1 lambda2, Isotype Control (HY-P990096) .

HY-148348

AB-836	HBV	Infection
AB-836 is an orally active *HBV* capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein. AB-836 can be used in research related to chronic hepatitis B .

HY-133721

Chamaechromone	HBV	Infection Inflammation/Immunology
Chamaechromone is a biflavonoid ingredient isolated from the roots of Stellera chamaejasme L. (Thymelaeaceae). Chamaechromone possesses anti-hepatitis B virus (HBV) effects against the surface antigen of HBV (HBsAg) secretion and has insecticidal activities .

HY-112142

AB-423 3 Publications Verification (R)-DVR-23	HBV	Infection
AB-423 is an inhibitor of HBV capsid assembly, and potent inhibits HBV replication with EC₅₀/EC₉₀ of 0.08-0.27 μM/0.33-1.32 μM in cells.

HY-116999

IR415	HBV	Infection
IR415 is a potent *anti-HBV* agent** and inhibits HBV replication by blocking the HBx activity. IR415 selectively interacts with HBx (K_d=2 nM) and blocks HBV-mediated RNAi suppression, reverses the inhibitory effect of HBx protein on the activity of the dicer endoribonuclease . HBx: hepatitis B virus X protein.

HY-100028

AT-130 2 Publications Verification	HBV DNA/RNA Synthesis	Infection Cancer
AT-130, a phenylpropenamide derivative, is a potent hepatitis B virus (HBV) replication non-nucleoside inhibitor. AT-130 inhibits the viral DNA synthesis with an EC₅₀ of 0.13 μM. AT-130 inhibits both wt and mutant HBVs. AT-130 has anti-HBV activity in hepatoma cells .

HY-114314

BA-53038B	HBV	Infection
BA-53038B is a HBV core protein allosteric modulator (CpAM), binding to the HAP pocket and modulating HBV capsid assembly. BA-53038B has antiviral activity for hepatitis B virus (HBV) with an EC₅₀ value of 3.32 μM. BA-53038B can be used for the research of chronic hepatitis B .

HY-148783

HBV-IN-32	HBV	Infection
HBV-IN-32 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-32 shows anti-HBV activity with an IC₅₀ value of 0.14 µM for HBsAg. HBV-IN-32 inhibits cell growth .

HY-146394

HBV-IN-22	HBV DNA/RNA Synthesis	Infection
HBV-IN-22 (Compound LC5f) is an inhibitor of HBV DNA replication with IC₅₀ values of 0.71 μM and 0.84 μM against wild-type and agent resistant HBV strains, respectively .

HY-145049

HBV-IN-6	HBV	Infection
HBV-IN-6 is a potent *HBV* inhibitor with an EC₅₀ of 44 nM (WO2021213445A1, compound 3) .

HY-148781

HBV-IN-30	HBV	Infection
HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .

HY-P4051

HBV Seq1 aa:141-151	HBV	Infection Inflammation/Immunology
HBV Seq1 aa:141-151 is a peptide. HBV Seq1 aa:141-151 can be used for the research of chronic hepatitis B virus (HBV) .

HY-14844

Lagociclovir MIV-210	HBV	Infection
Lagociclovir (FLG) is a nucleoside analogue that inhibits wild-type hepatitis B virus (HBV) replication in a human hepatoma cell line permanently expressing HBV .

HY-P4050

HBV Seq1 aa:18-27	HBV	Infection
HBV Seq1 aa:18-27 is a hepatitis B virus (HBV) core antigen 18-27 peptide fragment .

HY-174819

VNRX-9945	HBV	Infection
VNRX-9945 is a potent, broadly and orally active HBV CAM (capsid assembly modulator) with an EC₅₀ of 2.6 nM. VNRX-9945 exhibits excellent and broad antiviral activity against multiple HBV genotypes in vitro, along with favorable pharmacokinetic profiles across multiple species. VNRX-9945 demonstrates robust antiviral efficacy in the adeno-associated virus mice models of HBV (AAV-HBV) infection .

HY-148768

AB-506	HBV	Inflammation/Immunology
AB-506 is an orally active inhibitor of *HBV* replication targeting the viral core protein. AB-506 can bind to HBV core protein, accelerate capsid assembly and inhibit HBV pgRNA encapsidation. AB-506 can be used in chronic hepatitis B (CHB) research .

HY-177625

Daplusiran	HBV	Infection
Daplusiran is a siRNA in JNJ-3989 (JNJ-73763989). JNJ-3989 is comprised of 2 siRNAs (Daplusiran and Tomligisiran), that target hepatitis B virus (HBV) mRNAs for degradation, thereby inhibiting HBV replication.

HY-177667

Tomligisiran	HBV	Infection
Tomligisiran is a siRNA in JNJ-3989 (JNJ-73763989). JNJ-3989 is comprised of 2 siRNAs (Daplusiran and Tomligisiran), that target hepatitis B virus (HBV) mRNAs for degradation, thereby inhibiting HBV replication.

HY-168045

HBV-IN-48	HBV DNA/RNA Synthesis	Infection
HBV-IN-48 is an *HBV* inhibitor. HBV-IN-48 has antiviral activity against HBV in HepDE19 cells, with an EC₅₀ value of 0.005 μM. HBV-IN-48 can reduce serum HBV DNA levels in mouse models of HBV infection .

HY-177378

HBV-IN-53	HBV DNA/RNA Synthesis	Infection
HBV-IN-53 (Compound 1) is an *HBV* inhibitor. HBV-IN-53 reduces the level of HBV DNA in serum. The inhibitory activity of HBV-IN-53 in combination with Tenofovir disoproxil fumarate (HY-13782) exhibits an additive effect on HBV inhibition .

HY-146395

HBV-IN-23	HBV DNA/RNA Synthesis Apoptosis	Infection Cancer
HBV-IN-23 (Compound 5k) is an inhibitor of HBV DNA replication with an IC₅₀ of 0.58 μM. HBV-IN-23 inhibits HBV DNA replication in both agent sensitive and resistant HBV strains. HBV-IN-23 shows anti-hepatocellular carcinoma cell (HCC) activities. HBV-IN-23 induces HepG2 cells apoptosis .

HY-149815

HBV-IN-33	HBV	Infection Inflammation/Immunology
HBV-IN-33 (C-49), a *HBV* inhibitor, notably suppresses HBV replication in HepAD38, HepG2-HBV1.3 and HepG2-NTCP cells .

HY-149392

HBV-IN-35	HBV	Infection
HBV-IN-35 (Compound 88) is a *HBV* inhibitor. HBV-IN-35 has anti-HBV activities in mouse and human hepatocytes (EC₅₀: 100 nM and 400 nM respectively) .

HY-176059

HBV-IN-52	HBV	Infection
HBV-IN-52 is a selective *HBV* inhibitor. HBV-IN-52 is a Neplanocin A (HY-130430) derivative that demonstrates significant activity against HBV replication with EC₅₀ = 0.96 μM. HBV-IN-52 can inhibit HBsAg secretion (EC₅₀ = 0.82 μM. HBV-IN-52 can be studied in research for chronic hepatitis B (CHB) infections .

HY-163516

HBV-IN-45	HBV	Infection
HBV-IN-45 is a selective and orally active *HBV* capsid assembly modulator with an IC₅₀ of 0.51 μM for HBcAg in HBC cells. HBV-IN-45 shows potent anti-HBV activities .

HY-155968

HBV-IN-40	HBV	Infection
HBV-IN-40 (Compound 11826096) is a **HBV inhibitor (IC₅₀*: 0.7 μM). HBV-IN-40 is an antiviral agent .***

HY-131343

HBV-IN-4 1 Publications Verification	HBV DNA/RNA Synthesis	Infection
HBV-IN-4, a phthalazinone derivative, is a potent and orally active HBV DNA replication inhibitor with an IC₅₀ of 14 nM. HBV-IN-4 induces the formation of genome-free capsids and has potent anti-HBV potencies .

HY-173120

HBV-IN-51	HBV	Infection
HBV-IN-51 (Compound 17e) is a potent *HBV* capsid assembly modulator. HBV-IN-51 exhibits remarkable anti-HBV activity with an EC₅₀ of 0.033 μM in HepAD38 cells. HBV-IN-51 exhibits robust metabolic stability in plasma, and can be rapidly metabolized in human liver microsomes .

HY-148782

HBV-IN-31	HBV	Infection
HBV-IN-31 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-31 shows anti-HBV activity with an IC₅₀ value of 0.13 µM for HBsAg. HBV-IN-31 inhibits cell growth .

HY-159160

HBV-IN-46	HBV	Infection
HBV-IN-46 (compound 1.6) is an active metabolite. HBV-IN-46 is a HBV S-antigen inhibitor, with an EC₅₀ of 2.6 nM .

HY-155547

HBV-IN-34	HBV	Infection
HBV-IN-34 (compound 17i) is a potent HBsAg production inhibitor. HBV-IN-34 exhibits excellent in vitro anti-HBV potency, with an EC₅₀ of 0.018 μM and 0.044 μM for HBV DNA and HBsAg, respectively .

HY-146011

HBV-IN-21	HBV DNA/RNA Synthesis	Infection
HBV-IN-21 (Compound II-8b) is an HBV DNA replication inhibitor with an IC₅₀ of 2.2 µM. HBV-IN-21 can interact HBV 4 capsid protein with good affinity (K_D = 60.0 μM) .

HY-163124

HBV-IN-43	HBV	Infection
HBV-IN-43 (compound 5832) is a potent inhibitor of *HBV* .

HY-162795

HBV-IN-47	HBV	Infection
HBV-IN-47 (compound 4a) is a capsid assembly regulator with inhibitory activity against hepatitis B virus (HBV). HBV-IN-47 exhibits strong anti-HBV activity in HepAD38 cells with low toxicity (EC₅₀=0.24 μM). HBV-IN-47 can be used for the study of chronic hepatitis B (CHB) .

HY-149435

HBV-IN-36	HBV	Infection
HBV-IN-36 (compound 42) is a HBV inhibior (IC₅₀=2 μM), showing anti-HBV activity with EC₅₀ of 0.58 μM .

HY-156702

HBV-IN-38	HBV	Infection
HBV-IN-38 (Example 193) is an *HBV* DNA inhibitor (EC₅₀≤100nM). HBV-IN-38 can be used to study viral infections .

HY-151134

HBV-IN-25	HBV	Infection
HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC₅₀ values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA＞452 μg/mL) and good PK property with no cellular toxicity .

HY-156665

HBV-IN-37	HBV	Infection
HBV-IN-37 is an inhibitor of *HBV* with an EC₅₀ value of 10 μM .

HY-147863

HBV-IN-24	HBV	Infection Neurological Disease
HBV-IN-24 (compound (2ʹS, 6S)-1a) is a potent *HBV* inhibitor. HBV-IN-24 exhibits potent inhibition activity against HBV DNA, HBsAg, and HBeAg, with EC₅₀ values of 0.6, 0.6, and 4.6 nM, respectively. HBV-IN-24 shows excellent antiviral activity, could have improved neurotoxicity .

HY-163580

HBV/HDV-IN-3	HBV	Infection Inflammation/Immunology
HBV/HDV-IN-3 (Compd 1) is a dual *HBV* and HDV inhibitor, with an EC₅₀ of <50 nM against HBV .

HY-163581A

HBV/HDV-IN-4 hydrochloride	HBV	Infection Inflammation/Immunology
HBV/HDV-IN-4 hydrochloride (Compd 4) is a dual *HBV* and HDV inhibitor, with an EC₅₀ of <50 nM against HBV .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-B0150

Nicotinamide Maximum Cited Publications 89 Publications Verification Niacinamide; Nicotinic acid amide	Alkaloids Structural Classification Human Gut Microbiota Metabolites Microorganisms Neurological Disease Classification of Application Fields Pyridine Alkaloids Endogenous metabolite Disease Research Fields Source Classification Cancer	Environmental Pollutants Endogenous Metabolite Sirtuin HBV Organoid
Nicotinamide is a form of vitamin B3 or niacin. Nicotinamide Hydrochloride inhibits SIRT2 activity (IC₅₀: 2 μM). Nicotinamide also inhibits SIRT1. Nicotinamide increases cellular NAD₊, ATP, ROS levels. Nicotinamide inhibits tumor growth and improves survival. Nicotinamide also has anti-HBV activity .

HY-N0056

Isochlorogenic acid A 10+ Cited Publications 3,5-Dicaffeoylquinic acid; 3,5-CQA	Caprifoliaceae Classification of Application Fields Lonicera japonica Thunb. Ketones, Aldehydes, Acids Phenols Polyphenols Plants Endogenous metabolite Inflammation/Immunology Disease Research Fields Source Classification	Reactive Oxygen Species (ROS) HBV Endogenous Metabolite HIV Bacterial
Isochlorogenic acid A (3,5-Dicaffeoylquinic acid) is a natural phenolic acid with anti-mutagenicity, anti-HBV, anti-HIV, anti-oxidant, anti-bacterial, and anti-inflammatoryy activities .

HY-N0820

Catalpol 10+ Cited Publications Catalpinoside	Neurological Disease Classification of Application Fields Anti-aging Plants Rehmannia glutinosa (Gaert.) Libosch. ex Fisch. et Mey Infection Iridoids Terpenoids Scrophulariaceae Inflammation/Immunology Disease Research Fields Source Classification Cancer	HBV
Catalpol (Catalpinoside), an iridoid glycoside found in Rehmannia glutinosa. Catalpol has neuroprotective, hypoglycemic, anti-inflammatory, anti-cancer, anti-spasmodic, anti-oxidant effects and anti-HBV effects .

HY-B1192

Estradiol benzoate 15+ Cited Publications β-Estradiol 3-benzoate; 17β-Estradiol 3-benzoate	Classification of Application Fields Disease Research Fields Cancer	Estrogen Receptor/ERR HBV Bcl-2 Family
Estradiol benzoate (β-Estradiol 3-benzoate) is a HBx protein inhibitor and inhibits androgen and hepatitis B virus (HBV) transcription, replication. Estradiol benzoate shows antifertility effects, anti- Toxoplasma gondii activity and can improve memory behavior of Ovariectomy (Ovx) female mice .

HY-N0063

Punicalagin 10+ Cited Publications	Infection Structural Classification Punica granatum L. Classification of Application Fields Phenols Polyphenols Metabolic Disease Punicaceae Plants Disease Research Fields Source Classification	SARS-CoV HBV
Punicalagin is a polyphenol ingredient isolated from Pomegranate (Punica granatum L.) or the leaves of Terminalia catappa L.. Punicalagin is a reversible and non-competitive 3CL ^pro inhibitor and inhibits SARS-CoV-2 replication in vitro. Punicalagin is an anti-hepatitis B virus (HBV) agent and has antioxidant, anti-inflammatory, and anticancer effects. Punicalagin has the potential for the research of COVID-19 .

HY-N0054

Osthole 15+ Cited Publications Osthol; NSC 31868	Cardiovascular Disease Classification of Application Fields Coumarins Plants Biological Pesticide Research Agricultural Research Infection other families Phenylpropanoids Inflammation/Immunology Disease Research Fields Endocrinology Source Classification	Histamine Receptor Apoptosis Parasite HBV
Osthole (Osthol) is a natural antihistamine alternative. Osthole may be a potential inhibitor of histamine H₁ receptor activity. Osthole also suppresses the secretion of *HBV* in cells.

HY-N0639

Punicalin 2 Publications Verification	Punica granatum L. Classification of Application Fields Phenols Polyphenols Punicaceae Plants Inflammation/Immunology Disease Research Fields Source Classification	HBV Pyroptosis Carbonic Anhydrase
Punicalin is a species that can be isolated from the leaves of Punica granatum. Punicalin is an active molecule against hepatitis b virus (HBV). Punicalin can induce pyroptosis. Punicalin is a Carbonic anhydrase inhibitor. Punicalin blocks the binding of S-glycoprotein and ACE2 receptors. Pnuicalin has anti-inflammatory, antioxidant and antiviral activity .

HY-113308A

Taurolithocholic acid sodium salt 5+ Cited Publications	Structural Classification Animals Classification of Application Fields Metabolic Disease Disease Research Fields Steroids Source Classification	Calcium Channel Ferroptosis PI3K Reactive Oxygen Species (ROS) Akt HBV
Taurolithocholic acid sodium salt is an orally active bile acid and antiviral agent. Taurolithocholic acid sodium salt upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of *HBV/HDV, while reducing the release of IL-1β, lipid ROS* and LDH. While exerting antiviral protective effects, Taurolithocholic acid sodium salt also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid sodium salt serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid sodium salt shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid sodium salt not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-B0255

Adefovir dipivoxil 2 Publications Verification GS 0840	Infection Natural Products Classification of Application Fields Endogenous metabolite Disease Research Fields Source Classification Cancer	HBV Orthopoxvirus HSV DNA/RNA Synthesis ATM/ATR CDK
Adefovir dipivoxil is an orally active adenosine analog and Adefovir prodrug. Adefovir dipivoxil inhibits DNA synthesis, activates the ATR signaling pathway, and disrupts the KCTD12-CDK1 interaction. Adefovir dipivoxil has antiviral activity against PRV, *HBV, and orthopoxviruses. Adefovir dipivoxil has inhibitory effects on both lamivudine-resistant and wild-type strains*. Adefovir dipivoxil has antitumor activity against lung and colon cancer .

HY-N2189

Swertisin 2 Publications Verification	Iridaceae Classification of Application Fields Flavones Metabolic Disease Plants Iris tectorum Maxim. Flavonoids other families Phenols Polyphenols Inflammation/Immunology Disease Research Fields Source Classification	Adenosine Receptor HBV SGLT
Swertisin is an oral adenosine A1 receptor antagonist and an SGLT2 inhibitor. Swertisin has anti-diabetic, antioxidant properties, inhibits *HBV*, and improves cognitive and memory impairments in mice .

HY-N0699

Daphnoretin 3 Publications Verification Dephnoretin; Thymelol	Infection Structural Classification Monophenols Classification of Application Fields Thymelaeaceae Coumarins Phenols Phenylpropanoids Plants Disease Research Fields Source Classification Wikstroemia indica	PKC Influenza Virus NOD-like Receptor (NLR) Apoptosis HBV JNK PI3K Akt CDK Caspase Bcl-2 Family
Daphnoretin (Dephnoretin; Thymelol) is a protein kinase C (PKC) activator that inhibits the expression of hepatitis B virus (HBV) surface antigen (HBsAg) and exhibits antiviral activity. Daphnoretin exerts its antitumor effects by inhibiting the activation of the PI3K/AKT signaling pathway and triggers the mitochondrial apoptosis pathway. Daphnoretin alleviates chondrocyte apoptosis and inflammatory responses by inhibiting endoplasmic reticulum stress and activation of the NLRP3 inflammasome. Daphnoretin regulates the differentiation and maturation of dendritic cells, inhibits their immunostimulatory function by downregulating the phosphorylation level of JNK, and thus exerts a protective effect in skin graft rejection .

HY-N4168A

Neochlorogenic acid methyl ester 5-O-Caffeoylquinic acid methyl ester	Structural Classification Caprifoliaceae Lonicera japonica Thunb. Phenols Polyphenols Plants Source Classification	Quinone Reductase HBV
Neochlorogenic acid (5-O-Caffeoylquinic) methyl ester is a selective quinone reductase inducer (EC₅₀ = 6.7 μM) and also exhibits hydroxyl radical scavenging activity (EC₅₀ = 0.81 μM). Neochlorogenic acid methyl ester scavenges hydroxyl radicals by donating electrons or hydrogen atoms, while simultaneously inducing quinone reductase expression to enhance carcinogen detoxification, thus exerting antioxidant and cancer chemopreventive activities. Neochlorogenic acid methyl ester is used in research on antioxidant damage and promoting detoxification metabolism, primarily in the fields of cancer chemotherapy and antioxidant-related diseases. Neochlorogenic acid methyl ester is also an HBV inhibitor and can be isolated from the flower buds of L. japonica .

HY-N0444

Rubiadin	Quinones Structural Classification Classification of Application Fields Anthraquinones Rubiaceae Phenols Polyphenols Plants Morinda officinalis How Inflammation/Immunology Disease Research Fields Source Classification	Reactive Oxygen Species (ROS)
Rubiadin is an orally active polyketide-derived compound and free radical scavenger that inhibits the activation of the NF-κB pathway. Rubiadin inhibits osteoclast formation, bone resorption, lipid peroxidation, HBV DNA replication and cancer cell proliferation; reduces pro-inflammatory cytokine levels; induces cancer cell apoptosis; and possesses antifungal, antimalarial, antibacterial and anticonvulsant activities. Rubiadin can be used in the research of osteoporosis, acute inflammation, chronic inflammation, carbon tetrachloride-induced liver injury, Alzheimer's disease, breast cancer, iron overload disorders, hepatitis B virus infection, colon cancer, liver cancer, T-lymphocytic leukemia, cervical cancer, diabetic nephropathy, epileptic seizures, fungal infections, malaria and bacterial infections .

HY-N6939

Pseudolaric Acid B 2 Publications Verification	Infection Structural Classification Classification of Application Fields Pinaceae Terpenoids Diterpenoids Plants Inflammation/Immunology Disease Research Fields Cancer	HBV Fungal Apoptosis Autophagy Ferroptosis Interleukin Related HIF/HIF Prolyl-Hydroxylase
Pseudolaric Acid B is an orally active diterpene acid. Pseudolaric Acid B has anti-fungal, anti-fertility, anti-angiogenesis and anticancer activity, and can induce tumor cell apoptosis and autophagy. In addition, Pseudolaric Acid B can inhibit the secretion of hepatitis B virus (HBV) and has immunosuppressive effect, selectively inhibiting the proliferation of T lymphocytes and the production of IL-2 .

HY-N1365

Isoscopoletin 1 Publications Verification 6-Hydroxy-7-methoxycoumarin	Classification of Application Fields Coumarins Plants Compositae Infection Monophenols other families Phenols Phenylpropanoids Disease Research Fields Sindora sumatrana Miq. Source Classification Cancer	HBV p38 MAPK NF-κB STAT Akt ERK JNK
Isoscopoletin (6-Hydroxy-7-methoxycoumarin) is an active constituent in Artemisia argyi leaves. Isoscopoletin shows substantial inhibition against cell proliferation, with IC₅₀s of 4.0 μM and 1.6 μM for human CCRF-CEM leukaemia cells and multidrug resistant subline CEM/ADR5000, respectively . Isoscopoletin (6-Hydroxy-7-methoxycoumarin) possesses inhibitory activity against HBV replication . Isoscopoletin exhibits anti-inflammatory activity through inhibition of MAPK/NF-κB/STAT/AKT signaling pathway .

HY-149048

Adenosylhomocysteinase SAHH; AHCY	Infection Structural Classification Natural Products Classification of Application Fields Metabolic Disease Endogenous metabolite Disease Research Fields Source Classification	Exosomes Endogenous Metabolite HBV
Adenosylhomocysteinase (SAHH; AHCY) is a highly conserved enzyme. Adenosylhomocysteinase reversible catalyzes S-adenosylhomocysteine (SAH) to adenosine and L-homocysteine. The serum exosomal Adenosylhomocysteinase level can be used as a prognostic biomarker in HBV-LC patients .

HY-133721

Chamaechromone	Flavonoids Classification of Application Fields Thymelaeaceae Phenols Polyphenols Plants Biflavones Disease Research Fields Inflammation/Immunology Source Classification Stellera chamaejasme L.	HBV
Chamaechromone is a biflavonoid ingredient isolated from the roots of Stellera chamaejasme L. (Thymelaeaceae). Chamaechromone possesses anti-hepatitis B virus (HBV) effects against the surface antigen of HBV (HBsAg) secretion and has insecticidal activities .

HY-N0063R

Punicalagin (Standard)	Structural Classification Punica granatum L. Phenols Polyphenols Punicaceae Plants Source Classification	Reference Standards SARS-CoV HBV
Punicalagin (Standard) is the analytical standard of Punicalagin. This product is intended for research and analytical applications. Punicalagin is a polyphenol ingredient isolated from Pomegranate (Punica granatum L.) or the leaves of Terminalia catappa L.. Punicalagin is a reversible and non-competitive 3CLpro inhibitor and inhibits SARS-CoV-2 replication in vitro. Punicalagin is an anti-hepatitis B virus (HBV) agent and has antioxidant, anti-inflammatory, and anticancer effects. Punicalagin has the potential for the research of COVID-19 .

HY-W060316

β-Thujaplicinol 3-Hydroxy-5-isopropyltropolone	Cupressaceae Ketones, Aldehydes, Acids Plants Source Classification	HBV DNA/RNA Synthesis
β-Thujaplicinol (3-Hydroxy-5-isopropyltropolone) is an inhibitor of hepatitis B virus (HBV) ribonuclease H. β-Thujaplicinol inhibits RNAseHs of *HBV* genotypes D and H with IC₅₀ values of 5.9 and 2.3 μM, respectively .

HY-123336

Schisantherin C	Infection Classification of Application Fields Lignans Phenylpropanoids Plants Schisandraceae Disease Research Fields Schisandra chinensis (Turcz.) Baill. Source Classification	HBV
Schisantherin C exhibits anti-HBV activity with potency against HBsAg and HBeAg secretion by 59.7% and 34.7% at 50μg/mL .

HY-N5086

Picroside IV	Neurological Disease Classification of Application Fields Metabolic Disease Plants Monophenols Iridoids Terpenoids Phenols Scrophulariaceae Picrorhiza scrophulariiflora Pennell Inflammation/Immunology Disease Research Fields Source Classification	HBV
Picroside IV is an iridoid glycoside found in the underground parts of Picrorhiza scrophulariiflora. Picroside IV is a derivative of Catalpol (HY-N0820) . Catalpol has neuroprotective, hypoglycemic, anti-inflammatory, anti-cancer, anti-spasmodic, anti-oxidant effects and anti-HBV effects .

HY-N0855

Alisol G Alisol-G; 25-Anhydroalisol A	Triterpenes Structural Classification Alisma plantago-aquatica Linn. Classification of Application Fields Terpenoids Other Diseases Alismataceae Plants Disease Research Fields Source Classification	Carboxylesterase (CES) Bacterial HBV
Alisol G (25-Anhydroalisol A) is a human carboxylesterase 2 (hCES2) inhibitor with an IC₅₀ of 3.85 μM. Alisol G exhibits cytotoxic activity against human cancer cells, antibacterial activity against Gram-positive strains, and anti-hepatitis B virus activity. Alisol G can be used in research related to lung cancer, breast cancer, prostate cancer, bacterial infections, and HBV infections .

HY-N1365R

Isoscopoletin (Standard) 6-Hydroxy-7-methoxycoumarin (Standard)	Structural Classification Monophenols other families Coumarins Phenols Phenylpropanoids Plants Compositae Sindora sumatrana Miq. Source Classification	Reference Standards HBV p38 MAPK NF-κB STAT Akt ERK JNK
Isoscopoletin (Standard) is the analytical standard of Isoscopoletin. This product is intended for research and analytical applications. Isoscopoletin (6-Hydroxy-7-methoxycoumarin) is an active constituent in Artemisia argyi leaves. Isoscopoletin shows substantial inhibition against cell proliferation, with IC₅₀s of 4.0 μM and 1.6 μM for human CCRF-CEM leukaemia cells and multidrug resistant subline CEM/ADR5000, respectively . Isoscopoletin (6-Hydroxy-7-methoxycoumarin) possesses inhibitory activity against HBV replication . Isoscopoletin exhibits anti-inflammatory activity through inhibition of MAPK/NF-κB/STAT/AKT signaling pathway .

HY-N8153

Glycosmisic acid	Structural Classification Monophenols Classification of Application Fields Lignans Rubiaceae Phenols Phenylpropanoids Plants Gardenia jasminoides Ellis Inflammation/Immunology Disease Research Fields Source Classification	HBV
Glycosmisic acid, a natural compound, possesses *anti-HBV* activity .

HY-N8107

Matairesinol monoglucoside 2 Publications Verification	Structural Classification Monophenols other families Classification of Application Fields Lignans Other Diseases Phenols Phenylpropanoids Plants Disease Research Fields Source Classification	STING IFNAR HBV
Matairesinol monoglucoside is a STING activator. Matairesinol monoglucoside modulates the STING-TBK1-IRF3 signaling axis, promotes STING transcriptional expression, increases TBK1 and IRF3 phosphorylation. Matairesinol monoglucoside induces IFN-α and IFN-β production, reduces HBV DNA, HBsAg, and HBeAg expression. Matairesinol monoglucoside can be used for the research of hepatitis b virus (hbv) infection .

HY-B0150A

Nicotinamide hydrochloride Niacinamide hydrochloride; Nicotinic acid amide hydrochloride	Infection Structural Classification Alkaloids Classification of Application Fields Pyridine Alkaloids Endogenous metabolite Disease Research Fields Source Classification Cancer	Sirtuin Endogenous Metabolite HBV
Nicotinamide hydrochloride is a form of vitamin B3 or niacin. Nicotinamide hydrochloride inhibits SIRT2 activity (IC₅₀: 2 μM). Nicotinamide hydrochloride also inhibits SIRT1. Nicotinamide hydrochloride increases cellular NAD₊, ATP, ROS levels. Nicotinamide hydrochloride inhibits tumor growth and improves survival. Nicotinamide hydrochloride also has anti-HBV activity .

HY-113308AR

Taurolithocholic acid sodium salt (Standard)	Structural Classification Animals Steroids Source Classification	Reference Standards Calcium Channel Ferroptosis PI3K Reactive Oxygen Species (ROS) Akt HBV
Taurolithocholic acid (sodium salt) (Standard) is the analytical standard of Taurolithocholic acid (sodium salt). This product is intended for research and analytical applications. Taurolithocholic acid sodium salt is an orally active bile acid and antiviral agent. Taurolithocholic acid sodium salt upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of *HBV/HDV, while reducing the release of IL-1β, lipid ROS* and LDH. While exerting antiviral protective effects, Taurolithocholic acid sodium salt also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid sodium salt serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid sodium salt shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid sodium salt not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-N1323

Sanggenol P	Flavonoids Flavonones Plants Moraceae Source Classification Morus alba Linn.	HBV
Sanggenol P, a flavonoid, shows *anti-HBV* activity on HepG2.2.15 cell line in vitro .

HY-N0056R

Isochlorogenic acid A (Standard) 3,5-Dicaffeoylquinic acid (Standard); 3,5-CQA (Standard)	Structural Classification Caprifoliaceae Lonicera japonica Thunb. Ketones, Aldehydes, Acids Phenols Polyphenols Plants Endogenous metabolite Source Classification	Reference Standards Reactive Oxygen Species (ROS) HBV Endogenous Metabolite HIV Bacterial
Isochlorogenic acid A (Standard) is the analytical standard of Isochlorogenic acid A. This product is intended for research and analytical applications. Isochlorogenic acid A (3,5-Dicaffeoylquinic acid) is a natural phenolic acid with anti-mutagenicity, anti-HBV, anti-HIV, anti-oxidant, anti-bacterial, and anti-inflammatoryy activities .

HY-126033

Sophoranol	Infection Alkaloids Piperidine Alkaloids Classification of Application Fields Leguminosae Plants Sophora flavescens Aiton Disease Research Fields Source Classification	HBV RSV
Sophoranol is an alkaloid that can be isolated from S. flavescens, with antiviral activity. Sophoranol has anti-HBV (hepatitis B virus) activity. Sophoranol shows potent antiviral activities against respiratory syncytial virus (RSV) with an IC₅₀ of 10.4 μg/mL .

HY-N0820R

Catalpol (Standard) Catalpinoside (Standard)	Structural Classification Iridoids Terpenoids Scrophulariaceae Plants Rehmannia glutinosa (Gaert.) Libosch. ex Fisch. et Mey Source Classification	Reference Standards HBV
Catalpol (Standard) is the analytical standard of Catalpol. This product is intended for research and analytical applications. Catalpol (Catalpinoside), an iridoid glycoside found in Rehmannia glutinosa. Catalpol has neuroprotective, hypoglycemic, anti-inflammatory, anti-cancer, anti-spasmodic, anti-oxidant effects and anti-HBV effects .

HY-B0255R

Adefovir dipivoxil (Standard) GS 0840 (Standard)	Structural Classification Natural Products Endogenous metabolite Source Classification	Reference Standards HBV Reverse Transcriptase Orthopoxvirus Endogenous Metabolite
Adefovir dipivoxil (Standard) is the analytical standard of Adefovir dipivoxil. This product is intended for research and analytical applications. Adefovir dipivoxil is an orally active adenosine analog and Adefovir prodrug. Adefovir dipivoxil inhibits DNA synthesis, activates the ATR signaling pathway, and disrupts the KCTD12-CDK1 interaction. Adefovir dipivoxil has antiviral activity against PRV, *HBV, and orthopoxviruses. Adefovir dipivoxil has inhibitory effects on both lamivudine-resistant and wild-type strains*. Adefovir dipivoxil has antitumor activity against lung and colon cancer .

HY-N3609

Coclauril	Natural Products Cinnamomum subavenium Miq. Rhizophoraceae Bruguiera gymnorhiza (Linnaeus) Savigny Plants Lauraceae Source Classification	HBV
Coclauril is an inhibitor of *HBV. Coclauril inhibits HBV* replication in the human hepatoblastoma cell line with an EC₅₀ of 7.6 μg/mL .

HY-N10404

Junceellolide C	Animals Classification of Application Fields Terpenoids Diterpenoids Inflammation/Immunology Disease Research Fields Source Classification	HBV
Junceellolide C is a transcription inhibitor of cccDNA. Junceellolide C inhibits *HBV* DNA replication and significantly decreases the level of supernatant *HBV* RNA with EC₅₀ values of 5.19, 3.52 μM respectively in HepAD38 cells. Junceellolide C is a potent anti-HBV agent .

HY-W676876

Oxynitidine	Alkaloids Other Alkaloids Rutaceae Zanthoxylum nitidum (Roxb.) DC. Plants Source Classification	HBV
Oxynitidine is an *HBV* inhibitor (ID₅₀=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .

HY-N12105

Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside	Lignans Phenylpropanoids Plants Schisandraceae Illicium henryi Diels. Source Classification	HBV
Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside is an anti-hepatitis B virus (anti-HBV) agent. Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside inhibits HBV surface antigen (HBsAg) and HBV e antigen (HBeAg) secretion on Hep G2.2.15 cell line, with IC₅₀ values of 1.67 and >2.15 mM, respectively .

HY-N2882

Apigenin-4'-α-L-rhamnoside	Ranunculus sieboldii Miq. Flavonoids Flavones Ranunculaceae Plants Source Classification	HBV
Apigenin-4'-α-L-rhamnoside is a potent inhibitor of *HBV. Apigenin-4'-α-L-rhamnoside inhibits the secretory level of HBV* surface antigen (HBsAg) in HepG2.2.15 cells .

HY-N8168

LPRP-Et-97543	Infection Flavonoids Liliaceae Classification of Application Fields Phenols Polyphenols Plants Disporopsis aspera (Hua) Engl. Disease Research Fields Isoflavones Source Classification	HBV
LPRP-Et-97543 is a potent *anti-HBV* agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .

HY-N2988

Schisanwilsonin C Arisanschinin K	Classification of Application Fields Lignans Phenylpropanoids Plants Schisandraceae Disease Research Fields Inflammation/Immunology Source Classification Schisandra wilsoniana A. C. Smith	HBV
Schisanwilsonin C (Arisanschinin K) shows anti-HBV activity .

HY-N15419

Acutumidine	Alkaloids Other Alkaloids Plants Menispermaceae Hypserpa nitida Miers Source Classification	HBV
Acutumidine (compound 4) is an alkaloid with anti-HBV activity that can be isolated from Hypserpa nitida Miers. Acutumidine inhibits the production of HBsAg in Hep G2.2.15 cells stably transfected with *HBV* genome with an IC₅₀ value of 2.023 mM .

HY-W754691

Glaziovine	Alkaloids Other Alkaloids Plants Menispermaceae Hypserpa nitida Miers Source Classification	HBV
Glaziovine is an antiviral agent found in Hypserpa nitida. Glaziovine exhibits significant inhibitory activity against *HBV, capable of suppressing hepatitis B virus surface antigen (HBsAg) secretion in Hep G2.2.15 cells transfected with HBV, with an IC₅₀* of 8 nM .

HY-N11792

Pedunculosumoside F	Flavonoids Ophioglossaceae Plants Other Flavonoids Ophioglossum reticulatum L. Source Classification	HBV
Pedunculosumoside F is a homoflavonoid glucoside. Pedunculosumoside F can be isolated from Ophioglossum pedunculosum. Pedunculosumoside F has cytotoxicity against HepG2 22.15 cells with CC₅₀ value of 56.7 μM without anti-HBV activity. While its analogs block HBsAg secretion in HBV-infected HepG2 2.2.15 cells .

HY-N15262

Schinlignan B Angeloylgomisin P	Lignans Phenylpropanoids Plants Schisandraceae Schisandra chinensis (Turcz.) Baill. Source Classification	HIV HBV
Schinlignan B (Angeloylgomisin P) is a lignan with antioxidant, anti-HIV, anti-HBV activities, which is found in plants of the Schisandra genus. Schinlignan B is promising for research of antioxidant-associated diseases .

HY-N0054R

Osthole (Standard) Osthol (Standard); NSC 31868 (Standard)	Structural Classification other families Coumarins Phenylpropanoids Plants Source Classification	Reference Standards Histamine Receptor Apoptosis Parasite HBV
Osthole (Standard) is the analytical standard of Osthole. This product is intended for research and analytical applications. Osthole (Osthol) is a natural antihistamine alternative. Osthole may be a potential inhibitor of histamine H1 receptor activity. Osthole also suppresses the secretion of HBV in cells.

HY-N3093

Periglaucine B (+)-Periglaucine B	Alkaloids Pyrrole Alkaloids Pericampylus glaucus (Lam.) Merr. Plants Menispermaceae Source Classification	HBV
Periglaucine B ((+)-Periglaucine B) is an alkaloid and an HBsAg inhibitor. Periglaucine B can be isolated from Pericampylus glaucus. Periglaucine B inhibits the secretion of hepatitis B virus (HBV) surface antigen (HBsAg) in Hep G2.2.15 cells with an IC₅₀ of 0.47 mM .

HY-N3094

Periglaucine A	Alkaloids Pyrrole Alkaloids Labiatae Ulex europaeus L. Plants Source Classification	HBV HIV
Periglaucine A, a hasubanane-type alkaloid, can be isolated from Pericampylus glaucus. Periglaucine A can inhibits *HBV* surface antigen (HBsAg) secretion in Hep G2.2.15 cells. Periglaucine A also shows anti-HIV-1 activity in C8166 cells (EC₅₀: 204 μM) .

HY-107315

Alisol F 24-acetate	Triterpenes Alisma plantago-aquatica Linn. Terpenoids Plants Alismataceae Source Classification	HBV Apoptosis
Alisol F 24-acetate is a triterpene compound that can be isolated from the rhizomes of Alisma orientalis. Alisol F 24-acetate inhibits the secretion of *HBV* surface antigen HBsAg and HBeAg with IC₅₀ values of 7.7 µM and 5.1 µM. Alisol F 24-acetate has proapoptotic activity and can be used for cancer research .

HY-N12102

Dihydrodehydrodiconiferyl alcohol 9-O-α-L-rhamnopyranoside	Lignans Phenylpropanoids Plants Schisandraceae Illicium henryi Diels. Source Classification	HBV
Dihydrodehydrodiconiferyl alcohol 9-O-α-L-rhamnopyranoside (compound 1) is a lignan with anti-HBC activity. Dihydrodehydrodiconiferyl alcohol 9-O-α-L-rhamnopyranoside targets HBV surface antigen with IC₅₀s of 0.58 mM (HBsAg) and >2.4 mM (HBeAg). Dihydrodehydrodiconiferyl alcohol 9-O-α-L-rhamnopyranoside can be isolated from star anise .

HY-N0639R

Punicalin (Standard)	Structural Classification Punica granatum L. Phenols Polyphenols Punicaceae Plants Source Classification	Reference Standards HBV Pyroptosis Carbonic Anhydrase
Punicalin (Standard) is the analytical standard of Punicalin. This product is intended for research and analytical applications. Punicalin is a species that can be isolated from the leaves of Punica granatum. Punicalin is an active molecule against hepatitis b virus (HBV). Punicalin can induce pyroptosis. Punicalin is a Carbonic anhydrase inhibitor. Punicalin blocks the binding of S-glycoprotein and ACE2 receptors. Pnuicalin has anti-inflammatory, antioxidant and antiviral activity .

HY-N6939R

Pseudolaric Acid B (Standard)	Structural Classification Pinaceae Terpenoids Diterpenoids Plants	Reference Standards HBV Fungal Apoptosis Autophagy Ferroptosis HIF/HIF Prolyl-Hydroxylase Interleukin Related
Pseudolaric Acid B (Standard) is the analytical standard of Pseudolaric Acid B. This product is intended for research and analytical applications. Pseudolaric Acid B is an orally active diterpene acid. Pseudolaric Acid B has anti-fungal, anti-fertility, anti-angiogenesis and anticancer activity, and can induce tumor cell apoptosis and autophagy. In addition, Pseudolaric Acid B can inhibit the secretion of hepatitis B virus (HBV) and has immunosuppressive effect, selectively inhibiting the proliferation of T lymphocytes and the production of IL-2 .

Cat. No.	Product Name	Chemical Structure

HY-113904S

(Rac)-Tenofovir-d6
(Rac)-Tenofovir-d₆ is a labelled racemic Tenofovir. Tenofovir (GS 1278) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV) .

HY-113308S1

Taurolithocholic acid-d4

Taurolithocholic acid-d₄ is deuterium labeled Taurolithocholic acid. Taurolithocholic acid is an orally active bile acid and antiviral agent. Taurolithocholic acid upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic acid also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-13623S1

Entecavir-13C2,15N
Entecavir- ¹³C₂, ¹⁵N (BMS200475- ¹³C₂, ¹⁵N; SQ34676- ¹³C₂, ¹⁵N) is a ¹³C- and ¹⁵N-labeled Entecavir (HY-13623). Entecavir (SQ 34676; BMS 200475) is a potent and selective inhibitor of *HBV, with an EC₅₀* of 3.75 nM in HepG2 cell.

HY-B0150S3

Nicotinamide-d3
Nicotinamide-d₃ (Niacinamide-d₃) is deuterium labeled Nicotinamide. Nicotinamide is a form of vitamin B3 or niacin. Nicotinamide Hydrochloride inhibits SIRT2 activity (IC₅₀: 2 μM). Nicotinamide also inhibits SIRT1. Nicotinamide increases cellular NAD₊, ATP, ROS levels. Nicotinamide inhibits tumor growth and improves survival. Nicotinamide also has anti-HBV activity .

HY-113308AS1

Taurolithocholic Acid-d5 sodium salt

Taurolithocholic Acid-d₅ (sodium) is the deuterium labeled Taurolithocholic acid sodium salt. Taurolithocholic Acid sodium salt is an orally active bile acid and antiviral agent. Taurolithocholic Acid sodium salt upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic Acid sodium salt also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic Acid sodium salt serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic Acid sodium salt shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic Acid sodium salt not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-156703S

HBV-IN-39-d3
HBV-IN-39-d3 (Example 14) is a deuterated HBV-IN-39 (Example 13). HBV-IN-39 is an HBV inhibitor. HBV-IN-39-d3 has better oral bioavailability than HBV-IN-39 .

HY-B1826S2

Adefovir-d4
Adefovir-d₄ is the deuterium labeled Adefovir. Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC₅₀ of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses .

HY-13623S

Entecavir-d2
Entecavir-d₂ is the deuterium labeled Entecavir. Entecavir (SQ 34676; BMS 200475) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.

HY-B0017S

Telbivudine-d4
Telbivudine-d₄ is deuterium labeled Telbivudine. Telbivudine (Epavudine), an orally active thymidine nucleoside analog, is a potent antiviral inhibitor of hepatitis B virus (HBV) replication .

HY-17426S1

Famciclovir-d6
Famciclovir-d₆ (BRL 42810-d₆) is deuterium labeled Famciclovir. Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .

HY-B0250S1

Lamivudine-13C,15N2,d2
Lamivudine-13C,15N2,d2 (BCH-189-13C,15N2,d2) is a 13C, 15N, and deuterium labeled Lamivudine (HY-B0250). Lamivudine is an orally active and blood-brain barrier permeable nucleoside reverse transcriptase inhibitor (NRTI). Lamivudine inhibits HIV reverse transcriptase 1 and 2 and hepatitis B virus (HBV) reverse transcriptase .

HY-113308AS

Taurolithocholic acid-d4 sodium

Taurolithocholic acid-d₄ (sodium) is the deuterium labeled Taurolithocholic acid (sodium salt). Taurolithocholic acid sodium is an orally active bile acid and antiviral agent. Taurolithocholic acid sodium upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic acid sodium also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid sodium serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid sodium shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid sodium not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-113308AS2

Taurolithocholic acid-d4-1 sodium

Taurolithocholic acid-d₄-1 (sodium) is the deuterium labeled Taurolithocholic acid. Taurolithocholic acid sodium is an orally active bile acid and antiviral agent. Taurolithocholic acid sodium upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic acid sodium also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid sodium serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid sodium shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid sodium not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-113308S

Taurolithocholic acid-d5

Taurolithocholic acid-d₅ is deuterium labeled Taurolithocholic acid. Taurolithocholic acid is an orally active bile acid and antiviral agent. Taurolithocholic acid upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic acid also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-Z2862S

Entecavir-13C2,15N-1
Entecavir- ¹³C₂, ¹⁵N-1 is the ¹³C- and ¹⁵N-labeled Entecavir. Entecavir (SQ 34676; BMS 200475) is a potent and selective inhibitor of *HBV, with an EC₅₀* of 3.75 nM in HepG2 cell.

HY-W744757

Nicotinamide-15N

Nicotinamide- ¹⁵N (Niacinamide- ¹⁵N) is the deuterium labeled Nicotinamide (HY-B0150). Nicotinamide is a form of vitamin B3 or niacin. Nicotinamide Hydrochloride inhibits SIRT2 activity (IC₅₀: 2 μM). Nicotinamide also inhibits SIRT1. Nicotinamide increases cellular NAD+, ATP, ROS levels. Nicotinamide inhibits tumor growth and improves survival. Nicotinamide also has anti-HBV activity.

Targets Recommended: HBV

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-B0150G

Nicotinamide Niacinamide; Nicotinic acid amide	Endogenous Metabolite Sirtuin HBV	Infection Cancer
Nicotinamide (GMP) (Niacinamide (GMP)) is the GMP level of Nicotinamide (HY-B0150). GMP guidelines are used to produce Nicotinamide (GMP). GMP small molecules works appropriately as an auxiliary reagent for cell research manufacture. Nicotinamide is a form of vitamin B3 or niacin. Nicotinamide Hydrochloride inhibits SIRT2 activity (IC₅₀: 2 μM). Nicotinamide also inhibits SIRT1. Nicotinamide increases cellular NAD₊, ATP, ROS levels. Nicotinamide inhibits tumor growth and improves survival. Nicotinamide also has anti-HBV activity .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks