Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
87 Results for "
HBV DNA
" in MedChemExpress (MCE) Product Catalog:
Products (87)
87 Results for "HBV DNA" in MCE Product Catalog:
10
10 Publications Verification
Synonyms: RO 7020322; (S)-RO0321
RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells .
2
Target:
2
Target:
Research Areas:
Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses .
2
Target:
Research Areas:
Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM .
2
2 Cited Publications
GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM.
GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools . GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
2
2 Cited Publications
Target:
AT-130, a phenylpropenamide derivative, is a potent hepatitis B virus (HBV) replication non-nucleoside inhibitor. AT-130 inhibits the viral DNA synthesis with an EC50 of 0.13 μM. AT-130 inhibits both wt and mutant HBVs. AT-130 has anti-HBV activity in hepatoma cells .
2
2 Cited Publications
Cat. No.: HY-N8107
CAS No.: 34446-06-5
1
1 Cited Publications
Cat. No.: HY-D2468
1
Target:
Research Areas:
Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .
1
1 Cited Publications
Target:
Research Areas:
HBV-IN-4, a phthalazinone derivative, is a potent and orally active HBV DNA replication inhibitor with an IC50 of 14 nM. HBV-IN-4 induces the formation of genome-free capsids and has potent anti-HBV potencies .
Synonyms: FIAU; DRG-0098; NSC 678514
Research Areas:
Fialuridine (FIAU), a nucleoside analog, is a HSV-1 and HSV-2 inhibitor with Kis of 0.14 μM and 0.95 μM, respectively. Fialuridine shows anti-orthopoxvirus and anti-hepatitis B virus (HBV) activities. Fialuridine inhibits duck HBV DNA replication with IC50 values of 0.075 μM and 156 μM in human hepatoma cells and in chicken liver cells, respectively .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-177022
CAS No.: 2495324-66-6
ALG-001075, a capsid assembly modulator (CAM), is an orally active HBV inhibitor. ALG-001075 effectively blocks not only HBV DNA production but also extracellular HBsAg/HBeAg and intracellular HBV RNA in primary human hepatocytes. ALG-001075 shows pronounced reductions of circulating HBV DNA in the AAV-HBV mouse model. ALG-001075 can be used for the study of Chronic hepatitis B (CHB) .
Target:
Research Areas:
Antazoline hydrochloride is a histamine H1 receptor antagonist with anticholinergic and antiviral properties. Antazoline hydrochloride can prevent histamine from acting on target cells through a reversible competition effect on histamine receptor sites of these cells. Antazoline hydrochloride can exert an antiallegic effect and prevent the occurrence of physiological reactions from the effect of blocking as well as inhibiting H1 receptor. Antazoline hydrochloride can effectively reduce HBV DNA in the extracellular supernatant in a dose-dependent manner, with EC50 of 2.910 μmol/L in HepAD38 cells. Antazoline hydrochloride also has a significant inhibitory effect on HBV DNA in the extracellular supernatant of Huh7 cells (EC50 = 2.349 μmol/L). Antazoline hydrochloride has anti-arrhythmic effect in acute myocardial infarctions. Antazoline hydrochloride can be studied in research for cardiovascular diseases, and HBV .
Target:
Research Areas:
trans-ccc_R08 (Compound 1-B) is a cccDNA inhibitor with anti-HBV activity, with an IC50 of 0.14 μM for HBeAg and an IC50 of 0.08 μM for HBsAg in in vitro assays. trans-ccc_R08 inhibits covalently closed circular DNA (cccDNA). trans-ccc_R08 is applicable to research related to hepatitis B virus infection .
SAG-524 is a potent oral small molecule HBV viral replication inhibitor. SAG-524 decreased HBV-DNA and HbsAg levels in supernatant of HepG2.2.15 cells, IC50 0.92 and 1.4 nM, respectively .
Cat. No.: HY-169993
CAS No.: 2495324-72-4
Target:
Research Areas:
ALG-000184 is an orally effective inhibitor of hepatitis B virus (HBV), and it is also a prodrug of ALG-001075 (HY-177022). ALG-000184 can inhibit the production of HBV DNA in liver cells. ALG-000184 can be used in the research of chronic hepatitis B .
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
