Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
42 Results for "
DNA binding site
" in MedChemExpress (MCE) Product Catalog:
Products (42)
42 Results for "DNA binding site" in MCE Product Catalog:
14
14 Publications Verification
Synonyms: Diminazene diaceturate
Research Areas:
Diminazene aceturate (Diminazene diaceturate) is an anti-trypanosome agent for livestock. The main biochemical mechanism of the trypanocidal actions of Diminazene aceturate is by binding to trypanosomal kinetoplast DNA (kDNA) in a non-intercalative manner through specific interaction with sites rich in adenine-thymine base pairs. Diminazene aceturate is also an angiotensin-converting enzyme 2 (ACE2) activator and has strong and potent anti-inflammatory properties .
7
7 Cited Publications
Cat. No.: HY-19749
CAS No.: 181765-30-0
Target:
Research Areas:
PD 151746 is a selective calpain-1 inhibitor with an IC50 of 260 nM. PD 151746 binds μ-calpain Ca 2+-binding sites, and shows selectivity over cathepsin B, papain, trypsin, thermolysin, and basal calcineurin. PD 151746 reduces Oxidized low-density lipoprotein (oxLDL)-induced cytotoxicity, apoptotic DNA fragmentation, and blocks IL-1α maturation. PD 151746 can be used for the research of atherosclerosis and psoriasis .
4
4 Cited Publications
Cat. No.: HY-N0908
CAS No.: 186763-78-0
3
3 Cited Publications
Synonyms: Adenylyl-imidodiphosphate tetralithium
Target:
Research Areas:
AMP-PNP (Adenylyl-imidodiphosphate) tetralithium is a non-hydrolyzable ATP analog. AMP-PNP tetralithium binds to ATP binding sites competely but is not hydrolyzed by enzymes, providing stable experimental conditions for studying ATP-dependent processes. AMP-PNP tetralithium can also be used to study enzyme activity, kinase regulation, DNA/RNA metabolism, ion channel function, and protein complex assembly .
3
3 Cited Publications
Cat. No.: HY-130777A
Purity: ≥94.0%
Synonyms: Adenylyl imidodiphosphate lithium hydrate
2
Target:
2
Target:
Research Areas:
Aurothioglucose (Gold thioglucose), containing monovalent gold ion, is a potent active-site inhibitor of TrxR1 (thioredoxin reductase 1), with an IC50 of 65 nM. Aurothioglucose inhibits the DNA binding of NF-κB in vitro. Aurothioglucose shows anti-HIV and anti-rheumatic activities .
1
1 Cited Publications
Target:
Research Areas:
LEI110 is a pan-inhibitor of the HRASLS family and an inhibitor of AP-2α, with a Ki of 20 nM against PLA2G16. LEI110 exhibits inhibitory activity against PLA2G16, HRASLS2, RARRES3 and iNAT, with pIC50 values of 7.0, 6.8, 6.8 and 7.6, respectively. LEI110 binds to the active site of PLA2G16, reduces intracellular arachidonic acid levels, and attenuates oleic acid-induced lipolysis. LEI110 stabilizes AP-2α, impairs its DNA-binding ability, inhibits the transcription of DNA damage repair genes, induces the accumulation of oxidative DNA damage, suppresses cell proliferation and clonogenicity, and sensitizes HCC cells to DNA-damaging agents. LEI110 can be used in research related to obesity, fatty liver disease, the common cold and hepatocellular carcinoma .
Target:
Research Areas:
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-168534
CAS No.: 2929223-35-6
WX-02-23 is a small-molecule probe that stereoselectively and site-specifically binds to C258 of FOXA1 and C1111 of SF3B1. WX-02-23 remodels FOXA1's chromatin binding and pioneer activity in a DNA-dependent manner, disrupts spliceosome assembly, and enhances the thermal stability of SF3B1. WX-02-23 inhibits tumor cell proliferation and induces apoptosis. WX-02-23 can be used for research on cancers such as prostate cancer .
Cat. No.: HY-W012817
CAS No.: 95-71-6
Target:
Research Areas:
Melagatran is a reversible, selective, orally active direct inhibitor of thrombin with a Ki of 2 nM. Melagatran binds directly to the active site of thrombin, inhibiting thrombin-mediated conversion of fibrinogen to fibrin. Melagatran reduces the DNA binding activity of NF-κB and AP-1. Melagatran reduces fibrin deposition in organs, alleviates ischemic brain damage, and reduces the size of advanced atherosclerotic lesions. Melagatran can be used in the study of cardiovascular disease (coronary thrombosis, atherosclerosis) and ischemic brain damage .
Cat. No.: HY-W004883
CAS No.: 1193-71-1
Synonyms: 5A-DMP
Target:
Research Areas:
3-Amino-4,6-dimethylpyridine (5A-DMP) is a UHRF1 inhibitor that targets the Arg-binding cavity site within the UHRF1 TTD domain. 3-Amino-4,6-dimethylpyridine disrupts the interaction between UHRF1 and LIG1, interfering with DNA methylation, and can be utilized in cancer research .
Target:
Research Areas:
UNC-2170 is a functionally active, fragment-like ligand for 53BP1 (IC50=29 µM; Kd=22 µM). UNC-2170 shows at least 17-fold selectivity for 53BP1 as compared to nine other methyl-lysine (Kme) reader proteins. 53BP1 is a Kme binding protein that plays a central role in DNA Damage Repair (DDR) pathways and is recruited to sites of double-strand breaks (DSB) .
Cat. No.: HY-120105
CAS No.: 170747-33-8
Research Areas:
NSC666715 is a DNA polymerase β (Pol-β) inhibitor. NSC666715 directly and specifically interacts with Pol-β, interferes with its binding to damaged DNA, blocks its dRP lyase activity, and inhibits Pol-β-mediated SN- and LP-BER. NSC666715 induces AP site accumulation and S-phase cell cycle arrest, and triggers senescence and apoptosis (apoptosis) via the p53/p21 pathway in colorectal cancer cells. NSC666715 enhances TMZ (HY-17364)-induced DNA damage, senescence and apoptosis, and potentiates the cytotoxicity of TMZ. NSC666715 inhibits tumor growth in colon cancer xenograft models. NSC666715 can be used in research related to colorectal cancer .
Cat. No.: HY-175594
Target:
Research Areas:
DNMT2-IN-2 is a selective DNA methyltransferase 2 (DNMT2) inhibitor with a KD value of 3.04 μM. DNMT2-IN-2 targets to a cryptic allosteric binding site of DNMT2. DNMT2-IN-2 reduces m5C levels in MOLM-13 tRNA and synergizes with Doxorubicin (HY-15142A) to impair cell viability. DNMT2-IN-2 can be used for cancer research, such as cervical cancer and leukemia .
Cat. No.: HY-179433
Research Areas:
PROTAC AR Degrader-12 is a highly efficient PROTAC targeting AR coactivator binding site (AR-CBS). PROTAC AR Degrader-12 induces AR degradation in a ubiquitin proteasome system (UPS) pathway-dependent manner. PROTAC AR Degrader-12 inhibits tumor cell growth by affecting DNA replication and cell division PROTAC AR Degrader-12 could not only effectively degrade AR, but also potently inhibit the proliferation of MCF-7 and multiple mutant or resistant BC cells. PROTAC AR Degrader-12 effectively blocked estrogen receptor α (ERα) signaling through a dual mechanism involving ERα protein downregulation and suppression of its transcriptional activity. PROTAC AR Degrader-12 significantly inhibits the mRNA expression of FOXA1, GREB1, SRC, and PELP1. PROTAC AR Degrader-12 can be used for the study of breast cancer .
Cat. No.: HY-U00265
CAS No.: 20073-24-9
Synonyms: 3-Carbethoxypsoralen; 3-Ethoxycarbonylpsoralen
3-CPs is a monofunctional furanocoumarin and a photoprotective agent targeting Staphylococcus aureus DNA, possessesing anti-UVB lethal activity. 3-CPs competitively intercalates into DNA, forming exclusively 4',5'-furan-side mono-adducts upon UVB irradiation, and irreversibly inhibits the formation of cyclobutane pyrimidine dimers. 3-CPs prevents UVB-induced DNA damage by preferentially binding to strong (AT)n sites within the DNA, without inducing lethal interstrand DNA cross-links; the limited number of mono-adducts it induces can be efficiently repaired by bacteria. 3-CPs holds potential for use in the development of photoprotective formulations for skin diseases, as well as in studies investigating bacterial DNA photodamage repair mechanisms and the optimization of photochemotherapy safety .
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
