Search Result

Pathways Recommended:	Cell Cycle/DNA Damage

Results for "

DNA binding site

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA Methyltransferase (1) DNA/RNA Synthesis (7) Androgen Receptor (1) Angiotensin-converting Enzyme (ACE) (2) AP-1 (2) Apoptosis (5) Bacterial (1) Bcl-2 Family (1) Biochemical Assay Reagents (1) Caspase (1) COX (4) Drug Derivative (1) E1/E2/E3 Enzyme (1) Environmental Pollutants (1) Estrogen Receptor/ERR (2) Fluorescent Dye (1) HBV (2) HIV (3) HIV Integrase (1) HSV (1) IGF-1R (2) Ligands for E3 Ligase (1) MDM-2/p53 (3) Mitochondrial Metabolism (1) MMP (1) NF-κB (4) Parasite (2) PARP (1) Potassium Channel (1) PROTACs (1) Pyruvate Kinase (1) Reactive Oxygen Species (ROS) (2) Reference Standards (3) Reverse Transcriptase (1) SF3B1 (2) Src (1) STAT (2) Thrombin (1) Topoisomerase (1) UGT (1)
By Research Areas:	Cancer (21) Cardiovascular Disease (3) Endocrinology (2) Infection (9) Inflammation/Immunology (7) Metabolic Disease (3) Neurological Disease (2)
Oligonucleotides:	Antisense Oligonucleotides (2)

Inhibitors & Agonists

Screening Libraries

Fluorescent Dyes

Biochemical Assay Reagents

Peptides

Natural
Products

Oligonucleotides

Targets Recommended:

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-D2908

SYTO9	Fluorescent Dye	Others
SYTO9 is a green fluorescent nucleic acid dye (Ex = 485 nm, Em = 498 nm (DNA)/501 nm (RNA)). SYTO9 can penetrate the intact cell membrane of viable bacteria. When the cell membrane is damaged (cell death), its rate of entry into cells increases, and it competes with propidium iodide (PI) (HY-D0815), another membrane-impermeable dye, for nucleic acid binding sites. SYTO9 is widely used in fluorescence microscopy, flow cytometry, and fluorometric assays in microbiology for bacterial counting, viability assessment, and cell imaging .

HY-128933

AMP-PNP tetralithium 3 Publications Verification Adenylyl-imidodiphosphate tetralithium	Potassium Channel	Metabolic Disease
AMP-PNP (Adenylyl-imidodiphosphate) tetralithium is a non-hydrolyzable ATP analog. AMP-PNP tetralithium binds to ATP binding sites competely but is not hydrolyzed by enzymes, providing stable experimental conditions for studying ATP-dependent processes. AMP-PNP tetralithium can also be used to study enzyme activity, kinase regulation, DNA/RNA metabolism, ion channel function, and protein complex assembly .

HY-111832

1,2,3,6-Tetragalloylglucose TeGG	UGT	Infection Metabolic Disease
1,2,3,6-Tetragalloylglucose (TEgG) is a competitive inhibitor of UDP-glucuronyltransferase UGT1A1, targeting the competitive substrate binding site of UGT1A1. 1,2,3,6-Tetragalloylglucose inhibits UGT1A1-mediated β-estradiol 3-glucuronidation and SN-38 glucuronidation with IC₅₀ of 6.01 μM and 4.31 μM, respectively, and binds to UGT1A1 with K_i of 3.55 μM. 1,2,3,6-Tetragalloylglucose also induces tumor cell apoptosis, inhibit cell proliferation, activates caspase-3 and induces DNA fragmentation in HL-60 cells. 1,2,3,6-Tetragalloylglucose also inhibits HIV integrase and reverse transcriptase, and inhibits HCV protease .

HY-N0908

Ginsenoside Rg5 3 Publications Verification	IGF-1R NF-κB COX	Cardiovascular Disease Inflammation/Immunology Endocrinology Cancer
Ginsenoside Rg5 is the main component of Red ginseng and IGF-1R agonist. Ginsenoside Rg5 compets for the binding site of IGF-1R and blocks the binding of IGF-1 to IGF-1R (IC₅₀ about 90 nM). Ginsenoside Rg5 also inhibits the mRNA expression of COX-2 via suppression of the DNA binding activities of NF-κB p65.

HY-130777A

AMP-PNP lithium hydrate 3 Publications Verification Adenylyl imidodiphosphate lithium hydrate	Drug Derivative	Metabolic Disease
AMP-PNP (Adenylyl imidodiphosphate) lithium hydrate is a non-hydrolyzable ATP analog. AMP-PNP lithium hydrate binds to ATP binding sites competely but is not hydrolyzed by enzymes, providing stable experimental conditions for studying ATP-dependent processes. AMP-PNP lithium hydrate can also be used to study enzyme activity, kinase regulation, DNA/RNA metabolism, ion channel function, and protein complex assembly .

HY-12404

Diminazene aceturate Maximum Cited Publications 11 Publications Verification Diminazene diaceturate	Parasite Angiotensin-converting Enzyme (ACE)	Infection Inflammation/Immunology
Diminazene aceturate (Diminazene diaceturate) is an anti-trypanosome agent for livestock. The main biochemical mechanism of the trypanocidal actions of Diminazene aceturate is by binding to trypanosomal kinetoplast DNA (kDNA) in a non-intercalative manner through specific interaction with sites rich in adenine-thymine base pairs. Diminazene aceturate is also an angiotensin-converting enzyme 2 (ACE2) activator and has strong and potent anti-inflammatory properties .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-A0068

Aurothioglucose 2 Publications Verification Gold thioglucose	NF-κB HIV Reactive Oxygen Species (ROS)	Infection Inflammation/Immunology Cancer
Aurothioglucose (Gold thioglucose), containing monovalent gold ion, is a potent active-site inhibitor of TrxR1 (thioredoxin reductase 1), with an IC₅₀ of 65 nM. Aurothioglucose inhibits the DNA binding of NF-κB in vitro. Aurothioglucose shows anti-HIV and anti-rheumatic activities .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-168534

WX-02-23	SF3B1 Apoptosis	Cancer
WX-02-23 is a small-molecule probe that stereoselectively and site-specifically binds to C258 of FOXA1 and C1111 of SF3B1. WX-02-23 remodels FOXA1's chromatin binding and pioneer activity in a DNA-dependent manner, disrupts spliceosome assembly, and enhances the thermal stability of SF3B1. WX-02-23 inhibits tumor cell proliferation and induces apoptosis. WX-02-23 can be used for research on cancers such as prostate cancer .

HY-W012817

Methylhydroquinone	Environmental Pollutants COX	Inflammation/Immunology
Methylhydroquinone is an orally active COX inhibitor with IC₅₀s of 480.7 μM and 52.2 μM for ovine COX-1 and human recombinant COX-2, respectively. Methylhydroquinone has potential DNA damaging effects: 1) inhibiting COX-1 to reduce prostaglandin synthesis and exert anti-inflammatory activity; 2) inducing DNA single-strand breaks. Methylhydroquinone exerts its effects by competitively binding to the active sites of COX-1 (such as Tyr385, Met522) and non-covalent interactions .

HY-129056

Melagatran	Thrombin NF-κB AP-1	Cardiovascular Disease Neurological Disease
Melagatran is a reversible, selective, orally active direct inhibitor of thrombin with a K_i of 2 nM. Melagatran binds directly to the active site of thrombin, inhibiting thrombin-mediated conversion of fibrinogen to fibrin. Melagatran reduces the DNA binding activity of NF-κB and AP-1. Melagatran reduces fibrin deposition in organs, alleviates ischemic brain damage, and reduces the size of advanced atherosclerotic lesions. Melagatran can be used in the study of cardiovascular disease (coronary thrombosis, atherosclerosis) and ischemic brain damage .

HY-W004883

3-Amino-4,6-dimethylpyridine 5A-DMP	E1/E2/E3 Enzyme DNA/RNA Synthesis	Cancer
3-Amino-4,6-dimethylpyridine (5A-DMP) is a UHRF1 inhibitor that targets the Arg-binding cavity site within the UHRF1 TTD domain. 3-Amino-4,6-dimethylpyridine disrupts the interaction between UHRF1 and LIG1, interfering with DNA methylation, and can be utilized in cancer research .

HY-115531

UNC-2170	DNA/RNA Synthesis	Cancer
UNC-2170 is a functionally active, fragment-like ligand for 53BP1 (IC₅₀=29 µM; K_d=22 µM). UNC-2170 shows at least 17-fold selectivity for 53BP1 as compared to nine other methyl-lysine (Kme) reader proteins. 53BP1 is a Kme binding protein that plays a central role in DNA Damage Repair (DDR) pathways and is recruited to sites of double-strand breaks (DSB) .

HY-120105

NSC666715	DNA/RNA Synthesis Apoptosis MDM-2/p53 Bcl-2 Family Caspase PARP	Cancer
NSC666715 is a DNA polymerase β (Pol-β) inhibitor. NSC666715 directly and specifically interacts with Pol-β, interferes with its binding to damaged *DNA, blocks its dRP* lyase activity, and inhibits Pol-β-mediated SN- and LP-BER. NSC666715 induces AP site accumulation and S-phase cell cycle arrest, and triggers senescence and apoptosis (apoptosis) via the p53/p21 pathway in colorectal cancer cells. NSC666715 enhances TMZ (HY-17364)-induced DNA damage, senescence and apoptosis, and potentiates the cytotoxicity of TMZ. NSC666715 inhibits tumor growth in colon cancer xenograft models. NSC666715 can be used in research related to colorectal cancer .

HY-175594

DNMT2-IN-2	DNA Methyltransferase	Cancer
DNMT2-IN-2 is a selective DNA methyltransferase 2 (DNMT2) inhibitor with a K_D value of 3.04 μM. DNMT2-IN-2 targets to a cryptic allosteric binding site of DNMT2. DNMT2-IN-2 reduces m₅C levels in MOLM-13 tRNA and synergizes with Doxorubicin (HY-15142A) to impair cell viability. DNMT2-IN-2 can be used for cancer research, such as cervical cancer and leukemia .

HY-179433

PROTAC AR Degrader-12	PROTACs Androgen Receptor Estrogen Receptor/ERR Src	Cancer
PROTAC AR Degrader-12 is a highly efficient PROTAC targeting AR coactivator binding site (AR-CBS). PROTAC AR Degrader-12 induces AR degradation in a ubiquitin proteasome system (UPS) pathway-dependent manner. PROTAC AR Degrader-12 inhibits tumor cell growth by affecting DNA replication and cell division PROTAC AR Degrader-12 could not only effectively degrade AR, but also potently inhibit the proliferation of MCF-7 and multiple mutant or resistant BC cells. PROTAC AR Degrader-12 effectively blocked estrogen receptor α (ERα) signaling through a dual mechanism involving ERα protein downregulation and suppression of its transcriptional activity. PROTAC AR Degrader-12 significantly inhibits the mRNA expression of FOXA1, GREB1, SRC, and PELP1. PROTAC AR Degrader-12 can be used for the study of breast cancer .

HY-U00265

3-CPs 3-Carbethoxypsoralen; 3-Ethoxycarbonylpsoralen	Bacterial	Infection
3-CPs is a monofunctional furanocoumarin and a photoprotective agent targeting Staphylococcus aureus *DNA, possessesing anti-UVB lethal activity. 3-CPs competitively intercalates into DNA, forming exclusively 4',5'-furan-side mono-adducts upon UVB irradiation, and irreversibly inhibits the formation of cyclobutane pyrimidine dimers. 3-CPs prevents UVB-induced DNA* damage by preferentially binding to strong (AT)_n sites within the DNA, without inducing lethal interstrand DNA cross-links; the limited number of mono-adducts it induces can be efficiently repaired by bacteria. 3-CPs holds potential for use in the development of photoprotective formulations for skin diseases, as well as in studies investigating bacterial DNA photodamage repair mechanisms and the optimization of photochemotherapy safety .

HY-N0908R

Ginsenoside Rg5 (Standard)	Reference Standards IGF-1R NF-κB COX	Cardiovascular Disease Inflammation/Immunology Endocrinology Cancer
Ginsenoside Rg5 (Standard) is the analytical standard of Ginsenoside Rg5. This product is intended for research and analytical applications. Ginsenoside Rg5 is the main component of Red ginseng and IGF-1R agonist. Ginsenoside Rg5 compets for the binding site of IGF-1R and blocks the binding of IGF-1 to IGF-1R (IC50 about 90 nM). Ginsenoside Rg5 also inhibits the mRNA expression of COX-2 via suppression of the DNA binding activities of NF-κB p65.

HY-118897

UNC-2170 maleate	DNA/RNA Synthesis	Cancer
UNC-2170 maleate is the maleate salt form of UNC-2170 (HY-115531). UNC-2170 maleate is a selective inhibitor for the methyl-lysine binding protein 53BP1, with IC₅₀ of 29 µM and K_d of 22 µM. UNC-2170 maleate shows at least 17-fold selectivity for 53BP1 as compared to nine other methyl-lysine (Kme) reader proteins. 53BP1 is a Kme binding protein that plays a central role in DNA Damage Repair (DDR) pathways and is recruited to sites of double-strand breaks (DSB) .

HY-P5343

p53 CBS p53 Consensus binding sequence	MDM-2/p53	Others
p53 CBS (p53 Consensus binding sequence) is a biological active peptide. (p53 consensus DNA binding site)

HY-P4161

KWWCRW	DNA/RNA Synthesis	Cancer
KWWCRW is a Holliday linker inhibitory peptide with anticancer activity. KWWCRW inhibits homologous recombination repair (HDR) during DNA repair by binding to the reactive Holliday linker intermediate and preventing its degradation, and inhibits site-specific recombination by bacteriophage in vitro .

HY-19111

R-82150 TIBO-R 82150	HIV Reverse Transcriptase	Infection
R-82150 (TIBO-R 82150) is an HIV-1 reverse transcriptase inhibitor that blocks the reverse transcription of viral RNA by binding to the non-substrate binding site of reverse transcriptase, thereby inhibiting viral replication. R-82150 does not inhibit the replication of HIV-2, other RNA viruses, and DNA viruses .

HY-174386

STAT3-IN-43	STAT	Cancer
STAT3-IN-43 (Compound K2) is a covalent inhibitor targeting the allosteric site at the junction of the STAT3 coiled-coil domain and DNA-binding domain, with an IC₅₀ of 40.7 μM. STAT3-IN-43 can be used in cancer research .

HY-163566

Apoptosis inducer 18	Apoptosis	Cancer
Apoptosis inducer 18, a potent inducer of apoptosis, shows significant cytotoxicity to the breast cancer cell line MCF-7 (IC₅₀=0.559 μM). Apoptosis inducer 18 inhibits cell cycle progression and promotes apoptosis by binding to DNA and causing damage, and by binding to the active site of CDK-2, interfering with its kinase activity. Apoptosis inducer 18 can be used in anti-breast cancer research .

HY-141551

GNE-274	Estrogen Receptor/ERR	Cancer
GNE-274 is a structural analog of the ER degrader GDC-0927 and is a non-degrader. GNE-274 does not induce conversion of ER in breast cancer cell lines and functions as a partial ER agonist (partial ER agonist). GNE-274 increases the chromatin accessibility of ER-DNA binding sites, whereas GDC-0927 does not. GNE-274 is an effective ER ligand binding domain (LBD) inhibitor. GNE-274 can be used in cancer research.

HY-176727

WRN inhibitor 19	DNA/RNA Synthesis	Cancer
WRN inhibitor 19 (Compound 40) is a WRN helicase inhibitor (IC₅₀: 3.7 nM). WRN inhibitor 19 exhibits selective antiproliferative activity in WRN-dependent cancer cells. WRN inhibitor 19 inhibits WRN helicase function by competitively binding to the ATP site and induces DNA damage and cell cycle arrest. WRN inhibitor 19 can be used in the study of WRN-dependent cancers .

HY-170557

Topoisomerase IIα-IN-10	Topoisomerase Apoptosis Mitochondrial Metabolism	Cancer
Topoisomerase IIα-IN-10 (Compound 13r) is an inhibitor of Topoisomerase IIα. It binds to the active site of DNA when complexed with Topoisomerase IIα, and this binding is stabilized through interactions with DNA base pairs and amino acid residues. Topoisomerase IIα-IN-10 can induce Apoptosis by intercalating DNA and inhibiting Topoisomerase IIα, thereby disrupting the mitochondrial membrane potential and inhibiting the growth of HCT116 cell lines, with an IC₅₀ of 4.37 μM against HCT116 cells. Topoisomerase IIα-IN-10 can be used for research in the field of cancer treatment .

HY-W012817R

Methylhydroquinone (Standard)	COX Reference Standards	Others
Methylhydroquinone (Standard) is the analytical standard of Methylhydroquinone. This product is intended for research and analytical applications. Methylhydroquinone is an orally active COX inhibitor with IC50s of 480.7 μM and 52.2 μM for ovine COX-1 and human recombinant COX-2, respectively. Methylhydroquinone has potential DNA damaging effects: 1) inhibiting COX-1 to reduce prostaglandin synthesis and exert anti-inflammatory activity; 2) inducing DNA single-strand breaks. Methylhydroquinone exerts its effects by competitively binding to the active sites of COX-1 (such as Tyr385, Met522) and non-covalent interactions[1][2].

HY-N15327

Hyrtiosal	HIV HIV Integrase	Infection
Hyrtiosal, found in the marine sponge Hyrtios erectus, is an inhibitor of the N-terminal domain (NTD) of HIV-1 integrase (HIV-1 IN) with an IC₅₀ value of 9.60-0.86 μM. Hyrtiosal binds to the Ser17, Trp19, and Lys34 sites on the NTD of HIV-1 IN, inhibiting the binding of HIV-1 viral DNA to integrase and interfering with the formation of the pre-integrated complex of HIV-1. Hyrtiosal is promising for research of anti-HIV agents .

HY-12404R

Diminazene aceturate (Standard) Diminazene diaceturate (Standard)	Reference Standards Parasite Angiotensin-converting Enzyme (ACE)	Infection Inflammation/Immunology
Diminazene (aceturate) (Standard) is the analytical standard of Diminazene (aceturate). This product is intended for research and analytical applications. Diminazene aceturate (Diminazene diaceturate) is an anti-trypanosome agent for livestock. The main biochemical mechanism of the trypanocidal actions of Diminazene aceturate is by binding to trypanosomal kinetoplast DNA (kDNA) in a non-intercalative manner through specific interaction with sites rich in adenine-thymine base pairs. Diminazene aceturate is also an angiotensin-converting enzyme 2 (ACE2) activator and has strong and potent anti-inflammatory properties .

HY-185129

Headpiece	Biochemical Assay Reagents	Others
Headpiece is a short, covalently linked double-stranded DNA (dsDNA). It is designed as the starting point of DNA-Encoded Libraries (DELs) synthesis. In each chemical synthesis step, the compounds are encoded by enzymatically ligating the respective DNA tags to the Headpiece. Finally, a closing primer containing the distal primer-binding site for PCR amplification is added to complete the library synthesis/encoding.

HY-W471288

JPC0661	AP-1	Neurological Disease
JPC0661 is a direct and allosteric ΔFOSB inhibitor. JPC0661 inhibits the binding of ΔFOSB/JUND and ΔFOsB to DNA with IC₅₀ values in the micromolar range (9-52 uM), directly inhibits ΔFOSB-mediated transcription with IC₅₀ of 0.82 μM in vitro. JPC0661 significantly reduces ΔFOSB occupancy at genomic AP1 sites in vivo. JPC0661 binds to a novel groove outside the DNA-binding cleft of ΔFOSB and disrupt the formation of the *ΔFOSB*/JUND-DNA complex. JPC0661 can be used for Alzheimer's disease research .

HY-182983

DDB1 ligand-1	Ligands for E3 Ligase	Others
DDB1 ligand-1 is a DNA damage-binding protein 1 (DDB1) ligand. DDB1 ligand-1 binds to a unique pocket on the β propeller C (BPC) domain of DDB1, induces conformational changes, and blocks the canonical DCAF/HBx peptide binding site of DDB1. DDB1 ligand-1 engages full-length DDB1 in cellular settings and supports PROTAC development research .

HY-165381

ZMC2	MDM-2/p53 Reactive Oxygen Species (ROS)	Cancer
ZMC2 is a thiosemicarbazone-class metal ion chelator and zinc ionophore with a human mutant p53 ^R175H binding K_a of 27.4 nM.ZMC2 binds Fe, Cu, Mn, Zn, and other transition metals.ZMC2 facilitates zinc transport across membranes.ZMC2 restores zinc binding to zinc-deficient p53 mutants, restoring wild-type structure and function, including site-specific DNA binding.ZMC2 generates reactive oxygen species (ROS).ZMC2 can be used for the research of cancer .

HY-182037

Multi-target kinase-IN-9	DNA/RNA Synthesis Pyruvate Kinase	Cancer
Multi-target kinase-IN-9 is a multi-target enzyme inhibitor with antiproliferative and antiangiogenic activities, and exhibits remarkable selectivity against hepatocellular carcinoma cells. By broadly binding to the active sites or ATP-binding regions of multiple key enzymes including DNA polymerase β, Pyruvate Kinase M2 (PKM2), Multi-target kinase-IN-9 comprehensively disrupts DNA repair and replication, glycolysis, chromatin dynamics and transcriptional programs, and blocks the self-renewal of cancer stem cells. Multi-target kinase-IN-9 induces genomic instability, lysosomal dysfunction and autophagic flux impairment, thereby triggering tumor cell death, effectively inhibiting tumor proliferation, invasion, metastasis and angiogenesis, and significantly reducing tumor volume in xenograft models. Multi-target kinase-IN-9 is applicable to hepatocellular carcinoma-related research .

HY-P11137

LANA	HSV	Cancer
LANA is a KSHV latency-associated nuclear antigen. The core function of LANA is to act as an "anchor" for the viral genome, attaching it to the chromatin of the host cell. LANA ensures that the episomal DNA of KSHV replicates together with the host chromosome and is evenly distributed among the daughter cells, thereby maintaining the latent infection of the virus in the cell population. LANA can regulate the transcription of viral and host cell genes, and regulate certain host cell genes to promote cell survival. LANA can be used to study the viral DNA tethering structure .

HY-181421

WX-02-43	SF3B1	Cancer
WX-02-43 is a weak covalent inhibitor of SF3B1, and is the (1S,3R) enantiomer of WX-02-23 (HY-168534). WX-02-43 cannot effectively covalently modify the C258 site in the DNA-binding domain of FOXA1, and its inhibitory activity against SF3B1 is also weaker than that of WX-02-23. WX-02-43 serves as a negative control probe that fails to remodel the chromatin binding pattern and transcriptional activity of FOXA1. WX-02-43 can be used in studies on cancers such as prostate cancer to verify the specific effects of WX-02-23 on FOXA1 and SF3B1 targets .

HY-177990

STAT3-IN-52	STAT MMP Apoptosis	Cancer
STAT3-IN-52 (Compound 9) is a selective and orally active signal transducer and activator of transcription 3 (STAT3) inhibitor. STAT3-IN-52 binds to the pY705 site of STAT3 (K_i = 440 nM), blocking the phosphorylation and dimerization of STAT3. STAT3-IN-52 shows strong cytotoxicity against various cancer cells, such as breast cancer MDA-MB-231 (IC₅₀ = 0.7 μM), medulloblastoma UW426, pancreatic cancer BKPC3 cells. STAT3-IN-52 can induce cell apoptosis, inhibit the STAT3 nuclear transport and DNA binding activity and downregulate the expression of the STAT3 target gene MMP9. STAT3-IN-52 can be used for research related to STAT3 abnormal activation in cancer .

Cat. No.	Product Name

HY-LD004

DEL Covalent Library	14 million compounds
DEL technology enables the simultaneous screening of millions or billions of compounds in a single tube by covalently linking each small molecule with a unique DNA sequence. Traditional DEL screening primarily focuses on identifying non-covalent binding molecules, where interactions with the target are reversible. In contrast, DNA‑encoded covalent library is an ultra‑high‑throughput screening library developed on the basis of conventional DNA‑encoded library technology. It incorporates controllable electrophilic covalent warheads capable of forming irreversible covalent bonds with amino acid residues at the active sites of target proteins, including Cys, Lys, Ser, Tyr, and others. This covalent binding enhances binding affinity, prolongs residence time at the target site, and has the potential to overcome challenges associated with traditional non-covalent inhibitors, such as drug resistance or off-target effects. Each compound in the library contains both a binding domain and an electrophilic warhead. It first recognizes and binds to the target through non covalent interactions, and then forms a stable covalent bond with key amino acid residues to achieve irreversible inhibition. This library is specifically designed for the discovery of potent, long lasting, and highly selective covalent inhibitors, particularly for undruggable targets such as kinases, GPCRs, proteases, and mutant oncoproteins. Each molecule is uniquely labeled with a DNA barcode for molecular identification and sequencing decoding. This library is an advanced and highly diverse collection, consists of 35 independent sub-libraries with a total scaleof 14 million compounds, It incorporates over 14 experimentally validated covalent warheads capable of targeting cysteine, lysine, arginine, aspartic acid and glutamic acid. This library is constructed with diverse drug like core scaffolds and integrated controllable covalent warheads, it features structural diversity, reaction spec

DEL Covalent Library

14 million compounds

DEL technology enables the simultaneous screening of millions or billions of compounds in a single tube by covalently linking each small molecule with a unique DNA sequence. Traditional DEL screening primarily focuses on identifying non-covalent binding molecules, where interactions with the target are reversible. In contrast, DNA‑encoded covalent library is an ultra‑high‑throughput screening library developed on the basis of conventional DNA‑encoded library technology. It incorporates controllable electrophilic covalent warheads capable of forming irreversible covalent bonds with amino acid residues at the active sites of target proteins, including Cys, Lys, Ser, Tyr, and others. This covalent binding enhances binding affinity, prolongs residence time at the target site, and has the potential to overcome challenges associated with traditional non-covalent inhibitors, such as drug resistance or off-target effects.

Each compound in the library contains both a binding domain and an electrophilic warhead. It first recognizes and binds to the target through non covalent interactions, and then forms a stable covalent bond with key amino acid residues to achieve irreversible inhibition. This library is specifically designed for the discovery of potent, long lasting, and highly selective covalent inhibitors, particularly for undruggable targets such as kinases, GPCRs, proteases, and mutant oncoproteins. Each molecule is uniquely labeled with a DNA barcode for molecular identification and sequencing decoding.

This library is an advanced and highly diverse collection, consists of 35 independent sub-libraries with a total scaleof 14 million compounds, It incorporates over 14 experimentally validated covalent warheads capable of targeting cysteine, lysine, arginine, aspartic acid and glutamic acid. This library is constructed with diverse drug like core scaffolds and integrated controllable covalent warheads, it features structural diversity, reaction spec

Cat. No.	Product Name	Type

HY-D2908

SYTO9	Fluorescent Dyes
SYTO9 is a green fluorescent nucleic acid dye (Ex = 485 nm, Em = 498 nm (DNA)/501 nm (RNA)). SYTO9 can penetrate the intact cell membrane of viable bacteria. When the cell membrane is damaged (cell death), its rate of entry into cells increases, and it competes with propidium iodide (PI) (HY-D0815), another membrane-impermeable dye, for nucleic acid binding sites. SYTO9 is widely used in fluorescence microscopy, flow cytometry, and fluorometric assays in microbiology for bacterial counting, viability assessment, and cell imaging .

SYTO9

Fluorescent Dyes

SYTO9 is a green fluorescent nucleic acid dye (Ex = 485 nm, Em = 498 nm (DNA)/501 nm (RNA)). SYTO9 can penetrate the intact cell membrane of viable bacteria. When the cell membrane is damaged (cell death), its rate of entry into cells increases, and it competes with propidium iodide (PI) (HY-D0815), another membrane-impermeable dye, for nucleic acid binding sites. SYTO9 is widely used in fluorescence microscopy, flow cytometry, and fluorometric assays in microbiology for bacterial counting, viability assessment, and cell imaging .

Cat. No.	Product Name	Type

HY-130777A

AMP-PNP lithium hydrate 3 Publications Verification Adenylyl imidodiphosphate lithium hydrate	Biochemical Assay Reagents
AMP-PNP (Adenylyl imidodiphosphate) lithium hydrate is a non-hydrolyzable ATP analog. AMP-PNP lithium hydrate binds to ATP binding sites competely but is not hydrolyzed by enzymes, providing stable experimental conditions for studying ATP-dependent processes. AMP-PNP lithium hydrate can also be used to study enzyme activity, kinase regulation, DNA/RNA metabolism, ion channel function, and protein complex assembly .

AMP-PNP lithium hydrate

3 Publications Verification

Adenylyl imidodiphosphate lithium hydrate

Biochemical Assay Reagents

AMP-PNP (Adenylyl imidodiphosphate) lithium hydrate is a non-hydrolyzable ATP analog. AMP-PNP lithium hydrate binds to ATP binding sites competely but is not hydrolyzed by enzymes, providing stable experimental conditions for studying ATP-dependent processes. AMP-PNP lithium hydrate can also be used to study enzyme activity, kinase regulation, DNA/RNA metabolism, ion channel function, and protein complex assembly .

Cat. No.	Product Name	Target	Research Area

HY-A0299

H-Gly-Pro-Hyp-OH Tripeptide 29	Peptides	Inflammation/Immunology
H-Gly-Pro-Hyp-OH is a collagen-derived peptide and also a dipeptidyl peptidase-4 inhibitor.\nH-Gly-Pro-Hyp-OH inhibits the activity of dipeptidyl peptidase-4 in vitro. H-Gly-Pro-Hyp-OH binds to the DNA-binding site of the JUN/FOS complex, blocks the formation of the DNA-JUN/FOS complex, and inhibits transcriptional activity. H-Gly-Pro-Hyp-OH is applicable to research related to skin photoaging, UVB-induced skin aging/photoaging, and thrombosis .

HY-P5343

p53 CBS p53 Consensus binding sequence	MDM-2/p53	Others
p53 CBS (p53 Consensus binding sequence) is a biological active peptide. (p53 consensus DNA binding site)

HY-P4161

KWWCRW	DNA/RNA Synthesis	Cancer
KWWCRW is a Holliday linker inhibitory peptide with anticancer activity. KWWCRW inhibits homologous recombination repair (HDR) during DNA repair by binding to the reactive Holliday linker intermediate and preventing its degradation, and inhibits site-specific recombination by bacteriophage in vitro .

HY-P11137

LANA	HSV	Cancer
LANA is a KSHV latency-associated nuclear antigen. The core function of LANA is to act as an "anchor" for the viral genome, attaching it to the chromatin of the host cell. LANA ensures that the episomal DNA of KSHV replicates together with the host chromosome and is evenly distributed among the daughter cells, thereby maintaining the latent infection of the virus in the cell population. LANA can regulate the transcription of viral and host cell genes, and regulate certain host cell genes to promote cell survival. LANA can be used to study the viral DNA tethering structure .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-111832

1,2,3,6-Tetragalloylglucose TeGG	other families Classification of Application Fields Phenols Polyphenols Metabolic Disease Plants Disease Research Fields Source Classification	UGT
1,2,3,6-Tetragalloylglucose (TEgG) is a competitive inhibitor of UDP-glucuronyltransferase UGT1A1, targeting the competitive substrate binding site of UGT1A1. 1,2,3,6-Tetragalloylglucose inhibits UGT1A1-mediated β-estradiol 3-glucuronidation and SN-38 glucuronidation with IC₅₀ of 6.01 μM and 4.31 μM, respectively, and binds to UGT1A1 with K_i of 3.55 μM. 1,2,3,6-Tetragalloylglucose also induces tumor cell apoptosis, inhibit cell proliferation, activates caspase-3 and induces DNA fragmentation in HL-60 cells. 1,2,3,6-Tetragalloylglucose also inhibits HIV integrase and reverse transcriptase, and inhibits HCV protease .

HY-N0908

Ginsenoside Rg5 3 Publications Verification	Panax ginseng C. A. Meyer Cardiovascular Disease Triterpenes Classification of Application Fields Terpenoids Plants Inflammation/Immunology Disease Research Fields Araliaceae Endocrinology Source Classification	IGF-1R NF-κB COX
Ginsenoside Rg5 is the main component of Red ginseng and IGF-1R agonist. Ginsenoside Rg5 compets for the binding site of IGF-1R and blocks the binding of IGF-1 to IGF-1R (IC₅₀ about 90 nM). Ginsenoside Rg5 also inhibits the mRNA expression of COX-2 via suppression of the DNA binding activities of NF-κB p65.

HY-W012817

Methylhydroquinone	Structural Classification Natural Products Microorganisms Classification of Application Fields Other Diseases Disease Research Fields Source Classification	Environmental Pollutants COX
Methylhydroquinone is an orally active COX inhibitor with IC₅₀s of 480.7 μM and 52.2 μM for ovine COX-1 and human recombinant COX-2, respectively. Methylhydroquinone has potential DNA damaging effects: 1) inhibiting COX-1 to reduce prostaglandin synthesis and exert anti-inflammatory activity; 2) inducing DNA single-strand breaks. Methylhydroquinone exerts its effects by competitively binding to the active sites of COX-1 (such as Tyr385, Met522) and non-covalent interactions .

HY-N0908R

Ginsenoside Rg5 (Standard)	Panax ginseng C. A. Meyer Triterpenes Structural Classification Terpenoids Plants Araliaceae Source Classification	Reference Standards IGF-1R NF-κB COX
Ginsenoside Rg5 (Standard) is the analytical standard of Ginsenoside Rg5. This product is intended for research and analytical applications. Ginsenoside Rg5 is the main component of Red ginseng and IGF-1R agonist. Ginsenoside Rg5 compets for the binding site of IGF-1R and blocks the binding of IGF-1 to IGF-1R (IC50 about 90 nM). Ginsenoside Rg5 also inhibits the mRNA expression of COX-2 via suppression of the DNA binding activities of NF-κB p65.

HY-W012817R

Methylhydroquinone (Standard)	Natural Products Microorganisms Source Classification	COX Reference Standards
Methylhydroquinone (Standard) is the analytical standard of Methylhydroquinone. This product is intended for research and analytical applications. Methylhydroquinone is an orally active COX inhibitor with IC50s of 480.7 μM and 52.2 μM for ovine COX-1 and human recombinant COX-2, respectively. Methylhydroquinone has potential DNA damaging effects: 1) inhibiting COX-1 to reduce prostaglandin synthesis and exert anti-inflammatory activity; 2) inducing DNA single-strand breaks. Methylhydroquinone exerts its effects by competitively binding to the active sites of COX-1 (such as Tyr385, Met522) and non-covalent interactions[1][2].

HY-N15327

Hyrtiosal	Other Terpenoids Animals Terpenoids Source Classification	HIV HIV Integrase
Hyrtiosal, found in the marine sponge Hyrtios erectus, is an inhibitor of the N-terminal domain (NTD) of HIV-1 integrase (HIV-1 IN) with an IC₅₀ value of 9.60-0.86 μM. Hyrtiosal binds to the Ser17, Trp19, and Lys34 sites on the NTD of HIV-1 IN, inhibiting the binding of HIV-1 viral DNA to integrase and interfering with the formation of the pre-integrated complex of HIV-1. Hyrtiosal is promising for research of anti-HIV agents .

Cat. No.	Product Name		Classification

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium		Antisense Oligonucleotides
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

DNA binding site

Inhibitors & Agonists

Screening Libraries

Fluorescent Dyes

Biochemical Assay Reagents

Peptides

NaturalProducts

Oligonucleotides

Natural
Products