hsa-miR-27b-3p antagomir
Based on 1 publication(s) in Google Scholar
hsa-miR-27b-3p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:7046.58
-
Storage:
Please store the product under the recommended conditions in the Certificate of Analysis.
Publications Citing Use of MedChemExpress (MCE) hsa-miR-27b-3p antagomir
More
Biological Activity
Chemical Information
-
Molecular Weight 7046.58
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
UUCACAGUGGCUAAGUUCUGC
-
Stem-loop ID
hsa-mir-27b
-
Stem-loop Sequence
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG
-
Species
Human, Mouse, Rat, Astatotilapia burtoni, Bovine, Callithrix jacchus, Chicken, Chrysemys picta, Columba livia, Cricetulus griseus, Dasypus novemcinctus, Dog, Goat, Gorilla gorilla, Guinea pig, Horse, Ictalurus punctatus, Metriaclima zebra, Microcebus murinus, Monodelphis domestica, Neolamprologus brichardi, Oreochromis niloticus, Ornithorhynchus anatinus, Pan paniscus, Pan troglodytes, Petromyzon marinus, Pig, Pongo pygmaeus, Pteropus alecto, Pundamilia nyererei, Python bivittatus, Rabbit, Rhesus monkey, Saimiri boliviensis, Salmo salar, Sarcophilus harrisii, Taeniopygia guttata, Tupaia chinensis, Xenopus tropicalis
Publications (1)
-
Journal Impact Factor
-
Most Recent
-
J Cancer Res Clin Oncol
LncRNA LINC01128 promotes prostate cancer cell proliferation, metastasis, and epithelial-mesenchymal transition by modulating miR-27b-3p. [Abstract]2025 Mar 4;151(3):98. PMID: 40035871
Purity & Documentation
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)