hsa-miR-374a-5p agomir
Based on 1 publication(s) in Google Scholar
hsa-miR-374a-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:15083.34
-
Storage:
Please store the product under the recommended conditions in the Certificate of Analysis.
Publications Citing Use of MedChemExpress (MCE) hsa-miR-374a-5p agomir
More
Biological Activity
Description
Chemical Information
-
Molecular Weight 15083.34
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
UUAUAAUACAACCUGAUAAGUG
-
Stem-loop ID
hsa-mir-374a
-
Stem-loop Sequence
UACAUCGGCCAUUAUAAUACAACCUGAUAAGUGUUAUAGCACUUAUCAGAUUGUAUUGUAAUUGUCUGUGUA
-
Species
Human, Bovine, Dasypus novemcinctus, Guinea pig, Horse, Pan troglodytes, Pig, Pongo pygmaeus, Rabbit, Rhesus monkey, Sheep, Tupaia chinensis
Publications (1)
-
Journal Impact Factor
-
Most Recent
-
Am J Transl Res
Downregulated TRAF3IP2-AS1 promotes hepatocellular carcinoma progression through the miR-374a-5p/SEL1L1/RPL6 axis to enhance DNA damage repair. [Abstract]2025 Apr 15;17(4):2445-2466. PMID: 40385018
Purity & Documentation
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)