hsa-miR-648 antagomir
hsa-miR-648 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Para uso exclusivo en investigación. No vendemos a pacientes.
- Peso molecular:6302.11
-
Almacenamiento:
Please store the product under the recommended conditions in the Certificate of Analysis.
Actividad biológica
Chemical Information
-
Peso molecular 6302.11
-
Envío
Room temperature in continental US; may vary elsewhere.
-
Almacenamiento
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
AAGUGUGCAGGGCACUGGU
-
Stem-loop ID
hsa-mir-648
-
Stem-loop Sequence
AUCACAGACACCUCCAAGUGUGCAGGGCACUGGUGGGGGCCGGGGCAGGCCCAGCGAAAGUGCAGGACCUGGCACUUAGUCGGAAGUGAGGGUG
-
Species
Human, Pongo pygmaeus
Pureza y Documentación
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)