hsa-miR-760 antagomir
hsa-miR-760 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Nos produits utilisent uniquement pour la recherche. Nous ne vendons pas aux patients.
- Masse moléculaire:6644.37
-
Stockage:
Please store the product under the recommended conditions in the Certificate of Analysis.
Activité biologique
Chemical Information
-
Masse moléculaire 6644.37
-
Livraison
Room temperature in continental US; may vary elsewhere.
-
Stockage
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
CGGCUCUGGGUCUGUGGGGA
-
Stem-loop ID
hsa-mir-760
-
Stem-loop Sequence
GGCGCGUCGCCCCCCUCAGUCCACCAGAGCCCGGAUACCUCAGAAAUUCGGCUCUGGGUCUGUGGGGAGCGAAAUGCAAC
-
Species
Human, Mouse, Rat, Bovine, Cricetulus griseus, Pan troglodytes, Pongo pygmaeus, Rhesus monkey
Pureté et documentation
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)