IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain

  • FEBS J. 2006 Dec;273(24):5678-90. doi: 10.1111/j.1742-4658.2006.05556.x.
Gopal P Patel  1 ,  Jnanankur Bag
Affiliations
  • 1. Department of Molecular and Cellular Biology, University of Guelph, Ontario, Canada.
Abstract

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.