Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
98 Results for "
ISIS 333611-d27
" in MedChemExpress (MCE) Product Catalog:
Products (98)
98 Results for "ISIS 333611-d27" in MCE Product Catalog:
4
Target:
Research Areas:
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
4
Target:
Research Areas:
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
2
2 Cited Publications
Synonyms: BIIB067; ISIS-SOD1Rx; ISIS 333611
Target:
Research Areas:
Tofersen (BIIB067) is an antisense oligonucleotide and SOD1 mRNA inhibitor with an IC50 of 320 pM. Tofersen mediates RNase H-dependent degradation of SOD1 mRNA to reduce SOD1 protein levels in cerebrospinal fluid and serum. Tofersen downregulates cerebrospinal fluid neurofilament light chain, neurofilament heavy chain, amyloid-beta 1-40, amyloid-beta 1-42, neuropeptide Y, ubiquitin C-terminal hydrolase L1, neuropentraxins 1, 2, R, corticotropin-releasing hormone, IL-15, and serum neurofilament light chain, neurofilament heavy chain. Tofersen can be used for the research of superoxide dismutase 1-associated amyotrophic lateral sclerosis .
2
2 Cited Publications
Synonyms: ISIS-2922 sodium
Fomivirsen (ISIS-2922) sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen sodium is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
2
2 Cited Publications
Synonyms: BIIB067 sodium; ISIS-SOD1Rx sodium; ISIS 333611 sodium
Target:
Research Areas:
Tofersen (BIIB067) sodium is an antisense oligonucleotide and SOD1 mRNA inhibitor with an IC50 of 320 pM. Tofersen sodium mediates RNase H-dependent degradation of SOD1 mRNA to reduce SOD1 protein levels in cerebrospinal fluid and serum. Tofersen sodium downregulates cerebrospinal fluid neurofilament light chain, neurofilament heavy chain, amyloid-beta 1-40, amyloid-beta 1-42, neuropeptide Y, ubiquitin C-terminal hydrolase L1, neuropentraxins 1, 2, R, corticotropin-releasing hormone, IL-15, and serum neurofilament light chain, neurofilament heavy chain. Tofersen sodium can be used for the research of superoxide dismutase 1-associated amyotrophic lateral sclerosis .
2
Fomivirsen (ISIS-2922) is an antisense phosphorothioate oligonucleotide. Fomivirsen is an antiviral reagent used in research on cytomegalovirus (CMV) retinitis. Fomivirsen binds to and degrades the mRNA of CMV immediate-early 2 protein, thereby inhibiting viral proliferation. Fomivirsen can be used in research related to cytomegalovirus retinitis and cytomegalovirus diseases .
1
1 Cited Publications
Synonyms: ISIS 3521 sodium
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
Synonyms: ISIS-420915 sodium
Target:
Research Areas:
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
Synonyms: ISIS 304801 sodium
Target:
Research Areas:
Volanesorsen (ISIS 304801) sodium is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen sodium is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
Cat. No.: HY-112974
CAS No.: 1492984-65-2
Synonyms: GSK-2998728; ISIS-420915
Target:
Research Areas:
Inotersen (GSK-2998728; ISIS-420915) is a 2'-O-methoxyethyl-modified antisense oligonucleotide and transthyretin (TTR) inhibitor with low genotoxicity. Inotersen triggers RNase H1-mediated degradation by binding to TTR mRNA, thereby effectively reducing the production of both mutant and wild-type transthyretin in the liver. Inotersen significantly reduces amyloid fiber deposition, yet specific toxicities such as inflammation or tumors are observed at high doses in some animal models. Inotersen is used in studies of hereditary transthyretin amyloidosis and the associated polyneuropathy and cardiomyopathy .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: AKCEA-APO(a)-LRx sodium; ISIS 681257 sodium; TQJ230 sodium
Target:
Research Areas:
Pelacarsen sodium (ISIS 681257 sodium) is a GalNAc3-conjugated 2′-MOE-modified antisense oligonucleotide. Pelacarsen sodium reduces apo (a) .
Synonyms: ISIS 304801
Target:
Research Areas:
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
Cat. No.: HY-145725A
CAS No.: 1698048-23-5
Synonyms: ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx
Target:
Research Areas:
Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .
Cat. No.: HY-153491
CAS No.: 2097587-83-0
Synonyms: ISIS 678354; IONIS-APOCIII-LRx; AKCEA-APOCIII-LRx
Target:
Research Areas:
Olezarsen (ISIS 678354;IONIS-APOCIII-LRx) is a GalNAc-modified antisense oligonucleotide. Olezarsen binds to APOC3 mRNA and induces its degradation via ribonuclease H1-mediated sense strand cleavage, thereby reducing hepatic apolipoprotein C-III (apoC-III) synthesis. Olezarsen reduces plasma triglyceride, apolipoprotein B and non-high-density lipoprotein cholesterol levels. Olezarsen is applicable to research related to familial chylomicronemia syndrome, hypertriglyceridemia and atherosclerotic cardiovascular disease .
Synonyms: ISIS 678354 sodium; IONIS-APOCIII-LRx sodium; AKCEA-APOCIII-LRx sodium
Target:
Research Areas:
Olezarsen (ISIS 678354;IONIS-APOCIII-LRx) sodium is a GalNAc-modified antisense oligonucleotide. Olezarsen sodium binds to APOC3 mRNA and induces its degradation via ribonuclease H1-mediated sense strand cleavage, thereby reducing hepatic apolipoprotein C-III (apoC-III) synthesis. Olezarsen sodium reduces plasma triglyceride, apolipoprotein B and non-high-density lipoprotein cholesterol levels. Olezarsen sodium is applicable to research related to familial chylomicronemia syndrome, hypertriglyceridemia and atherosclerotic cardiovascular disease .
Cat. No.: HY-132582
CAS No.: 2304711-06-4
Synonyms: IONIS-MAPTRx; BIIB080; ISIS 814907
Target:
Research Areas:
Diranersen (IONIS-MAPTRx) is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen can be used in research related to Alzheimer's disease and tauopathies .
Cat. No.: HY-132582C
Purity: 91.82%
Synonyms: IONIS-MAPTRx sodium; BIIB080 sodium; ISIS 814907 sodium
Target:
Research Areas:
Diranersen (IONIS-MAPTRx) sodium is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen sodium can be used in research related to Alzheimer's disease and tauopathies .
0 Images
DNA, d(P-thio)([2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]m5rC-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]m5C-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]m5C-G-A-A-T-G-T-m5C-m5C-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]G-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]A-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA), sodium salt (1:15)
Synonyms: IONIS 598769 sodium; ISIS 598769 sodium
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
