hsa-miR-132-5p agomir
hsa-miR-132-5p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:15103.38
-
Storage:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Biological Activity
Chemical Information
-
Appearance Solid
-
Molecular Weight 15103.38
-
Color White to off-white
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
-
miRBase Accession Number
-
Mature miRNA Sequence
ACCGUGGCUUUCGAUUGUUACU
-
Stem-loop ID
hsa-mir-132
-
Stem-loop Sequence
CCGCCCCCGCGUCUCCAGGGCAACCGUGGCUUUCGAUUGUUACUGUGGGAACUGGAGGUAACAGUCUACAGCCAUGGUCGCCCCGCAGCACGCCCACGCGC
-
Species
Human, Rat, Cricetulus griseus, Dasypus novemcinctus, Guinea pig, Monodelphis domestica, Pteropus alecto, Rhesus monkey
Purity & Documentation
-
Data Sheet (230 KB)
-
SDS (252 KB)
- English - EN (252 KB)
- Français - FR (252 KB)
- Deutsch - DE (252 KB)
- Norwegian - NO (252 KB)
- Español - ES (252 KB)
- Swedish - SV (252 KB)
- Italian - IT (252 KB)
- Korean - KR (252 KB)
- Portuguese - PT (252 KB)
-
Handling Instructions (2659 KB)
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)