hsa-miR-6509-3p antagomir

Cat. No.: HY-RI01945A: Fiche technique Instruction de manipulation
FAQs
Technical Support

hsa-miR-6509-3p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Nos produits utilisent uniquement pour la recherche. Nous ne vendons pas aux patients.

RNA, (AAAUUAGGUAGUGGCAGUGG) (2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-6509-3p antagomir Chemical Structure

Size	Prix	Stock	Quantité
5 nmol		Obtenir un devis 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31
20 nmol		Obtenir un devis 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks	Estimated Time of Arrival: December 31

Synthetic products have potential research and development risk.

or Bulk Inquiry

* Veuillez sélectionner la quantité avant d'ajouter des articles.

This product is a controlled substance and not for sale in your territory.

Avis client

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-6509-3p antagomir:

hsa-miR-6509-3p inhibitor Obtenir un devis

Recommandations en vedette

•Related Small Molecules:

•Related Proteins:

Activité biologique
Pureté et documentation
Avis client

Description	hsa-miR-6509-3p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Masse moléculaire	7510.88
miRBase Accession Number	MI0022221
Mature miRNA Sequence	UUCCACUGCCACUACCUAAUUU
Stem-loop ID	hsa-mir-6509
Stem-loop Sequence	UUUUUGUGUGUGAAAUUAGGUAGUGGCAGUGGAACACUAUAUUAAUCAGGUUUCCACUGCCACUACCUAAUUUCUCAGAUGGAAA
Species	Human
Livraison	Room temperature in continental US; may vary elsewhere.
Stockage	Please store the product under the recommended conditions in the Certificate of Analysis.
Pureté et documentation	Fiche technique (229 KB) Instruction de manipulation (2659 KB)