1. Epigenetics
  2. Small Interfering RNA (siRNA)
  3. Cy3-siRNA Negative Control

Cy3-siRNA Negative Control is Cy3-labeled SiRNA Negative Control (HY-150150). Cy3-siRNA Negative Control can be used for easy visualization and assessment of transfection efficiency.

For research use only. We do not sell to patients.

RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (UUAAGAGGCUUGCACAGUGCA) (1:1), Cy3 labeled

Cy3-siRNA Negative Control Chemical Structure

Size Price Stock Quantity
1 mg In-stock
5 mg In-stock
10 mg   Get quote  
50 mg   Get quote  

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Other Forms of Cy3-siRNA Negative Control:

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

Cy3-siRNA Negative Control is Cy3-labeled SiRNA Negative Control (HY-150150). Cy3-siRNA Negative Control can be used for easy visualization and assessment of transfection efficiency.

In Vitro

Cy3-siRNA Negative Control can be used for the direct observation siRNA cellular uptake, distribution, and localization.
Cy3-siRNA Negative Control can be used to monitor transfection efficiency during optimization of transfection conditions.
Cy3-siRNA Negative Control allows for rapid monitoring of siRNA delivery by fluorescence microscopy.
Cy3-siRNA Negative Control is suitable for monitoring siRNA uptake by chemical transfection or electroporation.

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

Molecular Weight

13941.7 (free acid)

Appearance

Solid

Color

Pink to red

SMILES

[Cy3-siRNA Negative Control]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

-20°C, sealed storage, away from moisture and light

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture and light)

Purity & Documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Requested Quantity *

Applicant Name *

 

Salutation

Email Address *

 

Phone Number *

Department

 

Organization Name *

City

State

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
Cy3-siRNA Negative Control
Cat. No.:
HY-150150F
Quantity:
MCE Japan Authorized Agent: