SiRNA Negative Control

Name: SiRNA Negative Control
Brand: MedChemExpress
SKU: HY-150150
Rating: 5.0 (21 reviews)

Cat. No.: HY-150150 Purity: 99.24%: Data Sheet
COA

SDS
Handling Instructions
FAQs
Technical Support

SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. SiRNA Negative Control has no homology to most known gene sequence. SiRNA Negative Control can be used in human, mouse and rat cells in vitro. SiRNA Negative Control can be used as experimental control benchmark, verification of experimental reliability and standardization reference. SiRNA Negative Control is a common negative control used in most research articles.

For research use only. We do not sell to patients.

RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1)

Size	Stock	Quantity
1 mg	In-stock	Estimated Time of Arrival: December 31
5 mg	In-stock	Estimated Time of Arrival: December 31
10 mg	In-stock	Estimated Time of Arrival: December 31
50 mg	Get quote
100 mg	Get quote

or Bulk Inquiry

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 21 publication(s) in Google Scholar

Other Forms of SiRNA Negative Control:

Cy3-siRNA Negative Control In-stock

21 Publications Citing Use of MCE SiRNA Negative Control

Flow Cytometry

RT-PCR

Cell Proliferation/Viability Assay

Cell Imaging/Staining

: SiRNA Negative Control purchased from MedChemExpress. Usage Cited in: Mol Med. 2025 Sep 29;31(1):307. [Abstract]; SiRNA Negative Control (Si-NC)- or si-Miro1-transfected mGFP-EPO-BM-MSCs (showing a green fluorescence) were co-cultured with mtCC1-2 cells labeled with CellTrace Violet (showing a blue fluorescence). Flow cytometry analyzed the percentage of mtCC1-2 cells labeled with GFP and CellTrace Violet.

: SiRNA Negative Control purchased from MedChemExpress. Usage Cited in: Mol Med. 2025 Sep 29;31(1):307. [Abstract]; Immunoblotting of M-sec in SiRNA Negative Control (Si-NC)- or si-M-sec-transfected EPO-BM-MSCs.

: SiRNA Negative Control purchased from MedChemExpress. Usage Cited in: Mol Med. 2025 Sep 29;31(1):307. [Abstract]; Fluorescence microscopy and the percentage of TNT-forming cells between SiRNA Negative Control (si-NC)-transfected EPO-BM-MSCs or si-M-sec-transfected EPO-BM-MSCs.

: SiRNA Negative Control purchased from MedChemExpress. Usage Cited in: Ann Hepatol. 2025 Jan 3:101776. [Abstract]; Expression of PFKM mRNA transcript in MHCC97 and Huh-7 HCC cells transfected with SiRNA Negative Control (si-NC) or si-METTL16 (the 1:1 ratio mix of si-METTL16#1:si-METTL16#3) by quantitative PCR (n = 3).

: SiRNA Negative Control purchased from MedChemExpress. Usage Cited in: Ann Hepatol. 2025 Jan 3:101776. [Abstract]; SiRNA Negative Control (si-NC) (48 h). CCK-8 cell viability assay in transfected MHCC97 and Huh-7 HCC cells.

Featured Recommendations

•Related Small Molecules:

•Related Proteins:

Biological Activity
Purity & Documentation
Customer Review

Description

In Vitro

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

Molecular Weight

13323.03

Appearance

Solid

Color

White to off-white

SMILES

[RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1)]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Solvent & Solubility

In Vitro:

H₂O : 100 mg/mL (7.51 mM; Need ultrasonic)

Preparing
Stock Solutions

Concentration Solvent Mass	1 mg	5 mg	10 mg

1 mM	0.0751 mL	0.3753 mL	0.7506 mL
5 mM	0.0150 mL	0.0751 mL	0.1501 mL
10 mM	---	---	---

View the Complete Stock Solution Preparation Table

* Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.

* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.

Molarity Calculator
Dilution Calculator

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Concentration _(start) × Volume _(start) = Concentration _(final) × Volume _(final)

This equation is commonly abbreviated as: C₁V₁ = C₂V₂

Concentration _(start)

Volume _(start)

Concentration _(final)

Volume _(final)

In Vivo Dissolution Calculator

Please enter the basic information of animal experiments:

Dosage

mg/kg

Animal weight
(per animal)

Dosing volume
(per animal)

μL

Number of animals

Recommended: Prepare an additional quantity of animals to account for potential losses during experiments.

Calculation results:

Working solution concentration: mg/mL

This product has good water solubility, please refer to the measured solubility data in water/PBS/Saline for details.

The concentration of the stock solution you require exceeds the measured solubility. The following solution is for reference only.If necessary, please contact MedChemExpress (MCE).

Purity & Documentation

Purity: 99.24%

Select Batch:

Data Sheet (241 KB) SDS (252 KB)

COA (239 KB) RP-HPLC (252 KB) MS (490 KB)

Handling Instructions (2242 KB)

Complete Stock Solution Preparation Table

Optional Solvent	Concentration Solvent Mass	1 mg	5 mg	10 mg	25 mg

H₂O	1 mM	0.0751 mL	0.3753 mL	0.7506 mL	1.8764 mL
H₂O	5 mM	0.0150 mL	0.0751 mL	0.1501 mL	0.3753 mL

* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.