1. Epigenetics
  2. MicroRNA
  3. mmu-miR-23b-3p mimic

mmu-miR-23b-3p mimic 

Cat. No.: HY-R02851
Handling Instructions

mmu-miR-23b-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.

For research use only. We do not sell to patients.

mmu-miR-23b-3p mimic

mmu-miR-23b-3p mimic Chemical Structure

Size Stock
50 μg Get quote
200 μg Get quote

* Please select Quantity before adding items.

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

mmu-miR-23b-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.

Molecular Weight

13652.40

miRBase Accession Number
Mature miRNA Sequence

AUCACAUUGCCAGGGAUUACC

Stem-loop ID

mmu-mir-23b

Stem-loop Sequence

GGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUGAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACC

Species

Mouse, Rat, Anolis carolinensis, Astatotilapia burtoni, Callithrix jacchus, Chicken, Chrysemys picta, Cricetulus griseus, Cyprinus carpio, Daubentonia madagascariensis, Goat, Horse, Ictalurus punctatus, Metriaclima zebra, Microcebus murinus, Monodelphis domestica, Neolamprologus brichardi, Nomascus leucogenys, Oreochromis niloticus, Papio hamadryas, Pundamilia nyererei, Rhesus monkey, Taeniopygia guttata, Xenopus laevis, Xenopus tropicalis

SMILES

[mmu-miR-23b-3p mimic]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

Please store the product under the recommended conditions in the Certificate of Analysis.

Purity & Documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Salutation

Applicant Name *

 

Email address *

Phone number *

 

Organization name *

Department *

 

Requested quantity *

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
mmu-miR-23b-3p mimic
Cat. No.:
HY-R02851
Quantity:
MCE Japan Authorized Agent: