1. Epigenetics
  2. MicroRNA
  3. mmu-miR-3961 mimic

mmu-miR-3961 mimic 

Cat. No.: HY-R03125
Handling Instructions

mmu-miR-3961 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.

For research use only. We do not sell to patients.

mmu-miR-3961 mimic

mmu-miR-3961 mimic Chemical Structure

Size Stock
5nmol Get quote
20nmol Get quote

* Please select Quantity before adding items.

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

mmu-miR-3961 mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.

Molecular Weight

12396.60

miRBase Accession Number
Mature miRNA Sequence

UGCCCUCAGCUCAGUUGGA

Stem-loop ID

mmu-mir-3961

Stem-loop Sequence

AGAGGACCAAAUGCACUCAGAGCAGUUGAGUAUCAGCUGCCCUCAGCUCAGUUGGACAA

Species

Mouse

SMILES

[mmu-miR-3961 mimic]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

Please store the product under the recommended conditions in the Certificate of Analysis.

Purity & Documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Salutation

Applicant Name *

 

Email address *

Phone number *

 

Organization name *

Department *

 

Requested quantity *

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
mmu-miR-3961 mimic
Cat. No.:
HY-R03125
Quantity:
MCE Japan Authorized Agent: