sRNA196 promotes Pseudomonas aeruginosa virulence by regulating target genes PA4398, ZapE and PhoB
- Microb Cell Fact. 2026 Jan 27;25(1):50. doi: 10.1186/s12934-025-02920-9.
- 1. Department of Clinical Laboratory, Panyu Hexian Memorial Hospital of Guangzhou, Guangzhou, 511400, China.
- 2. College of Basic Medicine, Dali University, Dali, 671000, China.
- 3. Department of Clinical Laboratory, Success Hospital Affiliated to Xiamen University, Xiamen, 361000, Fujian, China.
- 4. Department of Clinical Laboratory, Qingyuan People's Hospital), The Affiliated Qingyuan Hospital, Guangzhou Medical University, Qingyuan, 511518, China.
- 5. Department of Clinical Laboratory, The Second Affiliated Hospital of Guangzhou, University of Chinese Medicine, Guangzhou, 510120, China.
- 6. Department of Clinical Laboratory, Panyu Hexian Memorial Hospital of Guangzhou, Guangzhou, 511400, China. [email protected].
- 7. Department of Clinical Laboratory, Qingyuan People's Hospital), The Affiliated Qingyuan Hospital, Guangzhou Medical University, Qingyuan, 511518, China. [email protected].
- 8. Department of Clinical Laboratory, Panyu Hexian Memorial Hospital of Guangzhou, Guangzhou, 511400, China. [email protected].
- # Contributed equally.
Bacterial sRNAs is important mechanisms regulating Bacterial pathogenesis. In this study, We screened a novel sRNA located at PA5007 closely associated with Pseudomonas Aeruginosa Infection by transcriptome sequencing196. And using transcriptome Sequencing as well as public databases, the sequence was found to be TCCGGGGCACGGCGCAGCATCGGCTCCAGGTCCTTGACCTGGTCGCGGCGGGCCGAACCA. We constructed sRNA196 gene-deficient and overexpression strains in PAO1 and demonstrated its presence by Northern blotting. The results showed that sRNA196 positively regulated pyocyanin synthesis, biofilm formation, and motility in P. aeruginosa. In addition, sRNA196 was able to promote P. aeruginosa adhesion and invasion ability in A549 cells as well as enhance P. aeruginosa survival in RAW264.7 cells. Furthermore, we demonstrated that sRNA196 can positively regulate several target genes including PA4398, ZapE, PhoB by fluorescense reporting system, and further verified the effects of these target genes on the relevant phenotypes. In summary, this study identified a new small RNA, sRNA196, that positively regulates virulence, which helps us to have a more comprehensive and clearer understanding of the role played by sRNAs in the regulation of virulence in P. aeruginosa.
-
Cat. No.Product NameDescriptionTargetResearch Area
-
Research Areas: Infection