hsa-miR-1246 antagomir
hsa-miR-1246 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
Para uso exclusivo en investigación. No vendemos a pacientes.
- Peso molecular:6271.11
-
Almacenamiento:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Actividad biológica
Descripciòn
Chemical Information
-
Appearance Solid
-
Peso molecular 6271.11
-
Color White to off-white
-
Envío
Room temperature in continental US; may vary elsewhere.
-
Almacenamiento
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
-
miRBase Accession Number
-
Mature miRNA Sequence
AAUGGAUUUUUGGAGCAGG
-
Stem-loop ID
hsa-mir-1246
-
Stem-loop Sequence
UGUAUCCUUGAAUGGAUUUUUGGAGCAGGAGUGGACACCUGACCCAAAGGAAAUCAAUCCAUAGGCUAGCAAU
-
Species
Human, Bovine, Pan troglodytes
Pureza y Documentación
-
Ficha de datos (230 KB)
-
SDS (252 KB)
- English - EN (252 KB)
- Français - FR (252 KB)
- Deutsch - DE (252 KB)
- Norwegian - NO (252 KB)
- Español - ES (252 KB)
- Swedish - SV (252 KB)
- Italian - IT (252 KB)
- Korean - KR (252 KB)
- Portuguese - PT (252 KB)
-
Instrucciones de manejo (2659 KB)
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)