1. Epigenetics
  2. MicroRNA
  3. hsa-miR-1288-3p agomir

hsa-miR-1288-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

For research use only. We do not sell to patients.

RNA, (UGGACUGCCCUGAUCUGGAGA), complex with RNA, (UCCAGAUCAGGGCAGUCCANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-1288-3p agomir Chemical Structure

Size Price Stock Quantity
5 nmol Get quote 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
20 nmol Get quote 2 - 3 Weeks 1 - 2 Weeks 3 - 4 Weeks 2 - 3 weeks
Synthetic products have potential research and development risk.

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-1288-3p agomir:

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

hsa-miR-1288-3p agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Molecular Weight

14547.06

miRBase Accession Number
Mature miRNA Sequence

UGGACUGCCCUGAUCUGGAGA

Stem-loop ID

hsa-mir-1288

Stem-loop Sequence

GAGGGUGUUGAUCAGCAGAUCAGGACUGUAACUCACCAUAGUGGUGGACUGCCCUGAUCUGGAGACCACUGCCUU

Species

Human, Pan troglodytes

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

Please store the product under the recommended conditions in the Certificate of Analysis.

Purity & Documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.
  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Requested Quantity *

Applicant Name *

 

Salutation

Email Address *

 

Phone Number *

Department

 

Organization Name *

City

State

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
hsa-miR-1288-3p agomir
Cat. No.:
HY-R00209A
Quantity:
MCE Japan Authorized Agent: