Copy Link Print Information

hsa-miR-346 agomir

hsa-miR-346 agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

Nos produits utilisent uniquement pour la recherche. Nous ne vendons pas aux patients.

  • Masse moléculaire:15827.85
  • Stockage:

    Please store the product under the recommended conditions in the Certificate of Analysis.

  • hsa-miR-346 agomir Chemical Structure
    hsa-miR-346 agomir Chemical Structure
Size
Prix
Stock
Quantité
Amount: USD 0.00
Please select quantity
or
or

* Veuillez sélectionner la quantité avant d'ajouter des articles.

To place orders, for customer services and technical support, please contact: MedChemExpress USA

Tel: 609-228-6898 E-mail: [email protected] [email protected]

Data Download
Other Forms of hsa-miR-346 agomir:

To place orders, for customer services and technical support, please contact:

609-228-6898
[email protected] [email protected]
Trouvez votre distributeur local Your local distributor: Hycultec GmbHHycultec
  • Activité biologique
  • Chemical Information
  • Pureté et documentation
  • Help & FAQs
Top Publications Citing

Use of MCE Products
Keywords
MOQ
Minimum order quantity
100 mg

Obtenir un devis En stock

Other size
Obtenir un devis
Please select quantity
Amount: USD 0.00
Sign in to MedChemExpress Sign In
Enregistrer
Sign in to MedChemExpress
Enregistrer un nouveau compte

At least 6 characters

Personalize your experience, you are currently not signed in. For a better experience, please create an online profile, you can:

Obtain points redemption prizes
Check out faster
Add multiple shipping locations
View orders
Assay Types
  • hsa-miR-346 agomir Chemical Structure
    hsa-miR-346 agomir Chemical Structure RNA, (UGUCUGCCCGCAUGCCUGCCUCU), complex with RNA, (AGGCAGGCAUGCGGGCAGACANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)
    1/16
  • RNA, (UGUCUGCCCGCAUGCCUGCCUCU), complex with RNA, (AGGCAGGCAUGCGGGCAGACANN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)