hsa-miR-4263 inhibitor
hsa-miR-4263 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
연구목적의 판매만을 진행합니다. 환자를 대상으로 한 판매는 하지 않습니다.
- 분자량:5367.61
-
보관:
Please store the product under the recommended conditions in the Certificate of Analysis.
Biological Activity
제품 설명
In Vitro
1. miRNA Resuspension
1.1 Briefly centrifuge the tube to ensure that the dried miRNA is at the bottom of the tube.
1.2 Resuspend the miRNA using nuclease free water to generate 20 μM stock solution.
For 5 nmol miRNA: add 250 μL nuclease free water.
For 20 nmol miRNA: add 1000 μL nuclease free water.
1.3 Aliquot miRNAs into one or more tubes to limit the number of freeze-thaw cycles (<5).
1.4 Store at or below -20°C or -80°C in a non-frost-free freezer until use.
2. Prepare cells
2.1 Inoculate cells in advance for cell transfection. The viability and general health of cells prior to transfection significantly affect transfection result.
3. Transfection
3.1 Prepare transfection mix A and B.
For per well of a 6-well plate: A: 240 μL serum-free medium + 10 μL miRNA; B: 230 μL serum-free medium + 20 μL HY-K2017 siRNA/miRNA Transfection Reagent.
For per well of a 12-well plate: A: 95 μL serum-free medium + 5 μL miRNA; B: 90 μL serum-free medium + 10 μL HY-K2017 siRNA/miRNA Transfection Reagent.
For per well of a 24-well plate: A: 47.5 μL serum-free medium + 2.5 μL miRNA; B: 45 μL serum-free medium + 5 μL HY-K2017 siRNA/miRNA Transfection Reagent.
For per well of a 96-well plate: A: 24.5 μL serum-free medium + 0.5 μL miRNA; B: 24 μL serum-free medium + 1 μL HY-K2017 siRNA/miRNA Transfection Reagent.
Note: The recommended working concentration is 100nM for miRNA inhibitors. miRNA function can vary greatly, depending on the miRNA, the cell line, and the chosen analysis method. To determine the concentration that provides optimal results, optimization experiments using varying mimic/inhibitor concentrations should be performed. The optimized range suggests changing the miRNA concentration in the range of 20 to 500nM.
If other transfection reagents are used, the amount of transfection reagent needs to be adjusted according to the specific situation.
3.2 Mix A and B gently. Incubate at room temperature for 15 minutes.
3.3 Remove culture medium from cells, wash with PBS.
3.4 Add transfection mix (A+B) to cells.
For per well of a 6-well plate: add 1500 μL serum-free medium, then add 500 μL of the transfection mix (A+B) to the well, and mix well.
For per well of a 12-well plate: add 800 μL serum-free medium, then add 200 μL of the transfection mix (A+B) to the well, and mix well.
For per well of a 24-well plate: add 400 μL serum-free medium, then add 100 μL of the transfection mix (A+B) to the well, and mix well.
For per well of a 96-well plate: add 50 μL serum-free medium, then add 50 μL of the transfection mix (A+B) to the well, and mix well.
3.5 Incubate cells for 1–3 days at 37°C. Then, analyze transfected cells. The medium can be replaced with fresh serum-containing medium after 6 hours if necessary.
Note: Antibiotics can increase toxicity and should be omitted during transfection. Culture medium containing polyanions such as heparin, heparin sulfate or dextran sulfate can inhibit transfection.
MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only. .
Chemical Information
-
분자량 5367.61
-
선적
Room temperature in continental US; may vary elsewhere.
-
보관
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
AUUCUAAGUGCCUUGGCC
-
Stem-loop ID
hsa-mir-4263
-
Stem-loop Sequence
AUAGUGCUCUUCAGGGUUUUACUUGGGAGAUUGGAGUGGCCAGUGUUCCUAAACAAUUCUAAGUGCCUUGGCCCACAACAUAC
-
Species
Human
순도&문서
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)