hsa-miR-4295 antagomir
Based on 1 publication(s) in Google Scholar
hsa-miR-4295 antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
For research use only. We do not sell to patients.
- Molecular Weight:6079.01
-
Storage:
Please store the product under the recommended conditions in the Certificate of Analysis.
Publications Citing Use of MedChemExpress (MCE) hsa-miR-4295 antagomir
More
Biological Activity
Chemical Information
-
Molecular Weight 6079.01
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
Please store the product under the recommended conditions in the Certificate of Analysis.
-
miRBase Accession Number
-
Mature miRNA Sequence
CAGUGCAAUGUUUUCCUU
-
Stem-loop ID
hsa-mir-4295
-
Stem-loop Sequence
CUUUGUGGAACAGUGCAAUGUUUUCCUUGCCUGUGGCAAGACCACUUCGGUUCAAGGCUAAGAAACUAGACUGUUCCUACAGAGA
-
Species
Human
Publications (1)
-
Journal Impact Factor
-
Most Recent
-
BMC Cancer
The LncRNA RMST-miR-4295-ITPR1 axis: a key mechanism in regulating autophagy in triple-negative breast cancer cells. [Abstract]2025 Apr 26;25(1):782. PMID: 40287640
Purity & Documentation
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)