Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
8 Results for "
Tofersen
" in MedChemExpress (MCE) Product Catalog:
Products (8)
8 Results for "Tofersen" in MCE Product Catalog:
2
2 Cited Publications
Synonyms: BIIB067; ISIS-SOD1Rx; ISIS 333611
Target:
Research Areas:
Tofersen (BIIB067) is an antisense oligonucleotide and SOD1 mRNA inhibitor with an IC50 of 320 pM. Tofersen mediates RNase H-dependent degradation of SOD1 mRNA to reduce SOD1 protein levels in cerebrospinal fluid and serum. Tofersen downregulates cerebrospinal fluid neurofilament light chain, neurofilament heavy chain, amyloid-beta 1-40, amyloid-beta 1-42, neuropeptide Y, ubiquitin C-terminal hydrolase L1, neuropentraxins 1, 2, R, corticotropin-releasing hormone, IL-15, and serum neurofilament light chain, neurofilament heavy chain. Tofersen can be used for the research of superoxide dismutase 1-associated amyotrophic lateral sclerosis .
2
2 Cited Publications
Synonyms: BIIB067 sodium; ISIS-SOD1Rx sodium; ISIS 333611 sodium
Target:
Research Areas:
Tofersen (BIIB067) sodium is an antisense oligonucleotide and SOD1 mRNA inhibitor with an IC50 of 320 pM. Tofersen sodium mediates RNase H-dependent degradation of SOD1 mRNA to reduce SOD1 protein levels in cerebrospinal fluid and serum. Tofersen sodium downregulates cerebrospinal fluid neurofilament light chain, neurofilament heavy chain, amyloid-beta 1-40, amyloid-beta 1-42, neuropeptide Y, ubiquitin C-terminal hydrolase L1, neuropentraxins 1, 2, R, corticotropin-releasing hormone, IL-15, and serum neurofilament light chain, neurofilament heavy chain. Tofersen sodium can be used for the research of superoxide dismutase 1-associated amyotrophic lateral sclerosis .
Cat. No.: HY-132580C
Target:
Research Areas:
Tofersen scrambled control is a scrambled control antisense oligonucleotide of Tofersen (HY-132580) with a scrambled sequence in the target binding region.
0 Images
CCTATAGGACTATCCAGGAA
Cat. No.: HY-153734
Purity: 92.18%
Cat. No.: HY-132580S
Synonyms: BIIB067-d27; ISIS-SOD1Rx-d27; ISIS 333611-d27
Cat. No.: HY-132580E
Target:
Research Areas:
FAM labled Tofersen sodiumis a FAM labled Tofersen sodium.
Cat. No.: HY-132580H
Target:
Research Areas:
Cy3 labled Tofersen sodium is a Cy3 labled Tofersen sodium.
Cat. No.: HY-132580D
Target:
Research Areas:
Tofersen sodium scrambled negative control is the sequence scrambled negative control of Tofersen sodium.
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
