Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
272 Results for "
RNA binding
" in MedChemExpress (MCE) Product Catalog:
Products (272)
272 Results for "RNA binding" in MCE Product Catalog:
2
Target:
Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .
2
2 Cited Publications
Cat. No.: HY-B0268A
CAS No.: 84294-96-2
Synonyms: Enoxacin sesquihydrate; AT-2266 hydrate; CI-919 hydrate
Target:
Enoxacin hydrate (Enoxacin sesquihydrate), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin hydrate is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin hydrate has potent activities against gram-positive and -negative bacteria. Enoxacin hydrate is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .
2
2 Cited Publications
Cat. No.: HY-153713
Purity: 98.05%
MYC-RIBOTAC is a nucleic acid-targeting degrader (ribonuclease-targeting chimera, RIBOTAC) that targets the MYC internal ribosome entry site (IRES). MYC-RIBOTAC contains a MYC mRNA binding component and a small molecule that recruits and locally activates RNAse L1. MYC-RIBOTAC reduces MYC mRNA and protein expression levels, induces cell apoptosis, and can be used for antitumor research . MYC-RIBOTAC consists of pre-miR-155 binder Anticancer agent 167 (HY-156839), RNA binder NCI-B16 (HY-156215), and Linker Amino-PEG4-alcohol (HY-W008005).
2
2 Cited Publications
Target:
Research Areas:
(R)-SKBG-1 is a covalent inhibitor targeting the RNA binding protein NONO. (R)-SKBG-1 can reduce the expression of androgen receptor (AR) and its splice variants, inhibiting cancer cell proliferation. (R)-SKBG-1 inhibits androgen receptor expression with IC50 of 3.1 μM and 5.5 μM for AR-FL mRNA and AR-V7 mRNA, respectively. (R)-SKBG-1 interferes with the gene regulatory network of cancer cells and inhibits cancer cell growth by stabilizing the interaction between NONO and mRNA. (R)-SKBG-1 can be used in the study of cancers related to NONO dysfunction, such as prostate cancer .
1
1 Cited Publications
Cat. No.: HY-P72145
Purity: ≥ 90%, as determined by reducing SDS-PAGE.
Synonyms: CIRBP; Glycine-Rich RNA binding Protein; Cold Inducible RNA binding Protein; A18 HnRNP; Cold-Inducible RNA-binding Protein; Cold Inducible RNA-binding Protein; CIRP; Testicular Tissue Protein Li 39; Glycine-Rich RNA-binding Protein CIRP; A18HNRNP
Species:
Mouse
Source:
E. coli
1
1 Cited Publications
Synonyms: N3-Methyluridine
Target:
1
1 Cited Publications
Target:
Research Areas:
Puromycin-bis (PEG2-amide)-Biotin (Compound 3P) is a binding molecule. Puromycin-bis (PEG2-amide)-Biotin binds to ribosome-RNA complexes within single cells. Puromycin-bis (PEG2-amide)-Biotin is used for single-cell translatome sequencing .
1
1 Cited Publications
KH-3 is a potent RNA-binding protein Hu antigen R (HuR) inhibitor with an IC50 value of 0.35 μM. KH-3 has anti-proliferative activity. KH-3 suppresses breast cancer cell invasion as well as delays the initiation of lung colonies by disrupting HuR-FOXQ1 mRNA interaction .
1
1 Cited Publications
Target:
Research Areas:
Anticancer agent 73 (compound CIB-3b) is a anticancer agent, potently targeting TAR RNA-binding protein 2 (TRBP) and disrupts its interaction with Dicer. Anticancer agent 73 can rebalance the expression profile of oncogenic or tumor-suppressive miRNAs. Anticancer agent 73 suppresses the proliferation and metastasis of HCC in vitro and in vivo .
1
Target:
Research Areas:
Framycetin (Neomycin B), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections .
1
1 Cited Publications
Synonyms: Neomycin B sulfate; Fradiomycin B sulfate
Target:
Research Areas:
Framycetin sulfate (Neomycin B sulfate), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin sulfate competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin sulfate inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin sulfate, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections .
1
1 Cited Publications
Cat. No.: HY-174228
CAS No.: 552829-57-9
Target:
Research Areas:
I3IN-002 is a small-molecule RNA-binding protein IGF2BP3 inhibitor with an IC50 value of approximately 2 μM in SEM cells. I3IN-002 interferes with interaction with m6 A-modified mRNAs, disrupting the stabilization of target genes (such as CDK6, MYC, and BCL2) to inhibit leukemic cell growth, induce cell cycle arrest, and promote apoptosis. I3IN-002 is promising for research of B-cell acute lymphoblastic leukemia .
1
1 Cited Publications
Target:
Research Areas:
BTYNB is a structure-specific nucleic acid binder and IGF2BP1 inhibitor (with an IC50 of 5 μM against hBTYNB). BTYNB disrupts the IGF2BP1-RNA interaction and blocks its binding to oncogenic mRNAs such as c-Myc, MDM2, PD-L1. BTYNB completely blocks the INHBA-Smad2/3 pathway, disrupts the MYCN/IGF2BP1 loop, and thereby induces apoptosis and cell cycle arrest, effectively inhibiting the proliferation and survival of cancer cells. In addition, BTYNB acts as an immune activator and tumor microenvironment modulator, enhances T cell-mediated tumor killing, and produces significant synergistic effects with inhibitors of PD-1, BRD and BIRC5. BTYNB can be used in relevant research on various malignant tumors including ovarian cancer, neuroblastoma, leukemia and melanoma .
1
Category:
Infection Microorganisms Antibiotics Resistance Selection Disease Research Antibacterial Disease Research Fields Other Antibiotics
Target:
Ribostamycin sulfate (Vistamycin sulfate) is a broad-spectrum aminoglycoside Antibiotic with bactericidal activity against Gram-positive cocci, Gram-negative cocci, bacilli, and drug-resistant strains. Ribostamycin sulfate also acts as an inhibitor of protein disulfide isomerase (PDI), with a binding constant KD of 319 μM for bovine PDI. Ribostamycin sulfate targets bacterial 16S ribosomal RNA and the 30S ribosomal subunit, causing translational misreading and thereby inhibiting bacterial protein synthesis. Ribostamycin sulfate disrupts the integrity of bacterial cell membranes, induces membrane pore formation, and leads to bacterial death. Ribostamycin sulfate can be used in studies related to bacterial infections .
1
1 Cited Publications
Cat. No.: HY-172158
CAS No.: 140481-05-6
Research Areas:
ALKBH5-IN-5 is a highly selective ALKBH5 (IC50 = 0.62 μM, Kd = 804 nM). ALKBH5-IN-5 disrupts ALKBH5 binding to m 6A-RNA and 6mA-DNA substrates. ALKBH5-IN-5 promotes differentiation, induces apoptosis, cause G2-M phase arrest and exerts strong antiproliferative effects in cancer cells. ALKBH5-IN-5 reduces TACC3 and MYC protein levels and increases cleaved caspase-3 levels. ALKBH5-IN-5 exerts antitumor activity in tumor xenograft mice models. ALKBH5-IN-5 can be used for the research of acute myeloid leukemia .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-P5960
Synonyms: PTBP1 α3-helix derived peptide P6 TFA
Target:
Research Areas:
Cat. No.: HY-176471
CAS No.: 3070282-38-8
Target:
Research Areas:
IGF2BP3-IN-1 (Compound I3IN-122) is an IGF2BP3 (a RNA binding protein) inhibitor (IC50: > 50 μM), and can be used for cancer research .
Cat. No.: HY-W040198
CAS No.: 81-93-6
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
