Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
141 Results for "
DNA sequence
" in MedChemExpress (MCE) Product Catalog:
Products (141)
141 Results for "DNA sequence" in MCE Product Catalog:
Synonyms: DRG16
Research Areas:
SG2057 (DRG16) is a PBD dimer containing a pentyldioxy linkage which binds sequence selectively in the minor groove of DNA forming DNA interstrand and intrastrand cross-linked adducts. SG2057 is a highly active antitumor agent .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-W406070
CAS No.: 207131-16-6
Synonyms: LNA-G
Research Areas:
2′-O,4′-C-Methyleneguanosine (LNA-G) is a reverse guanine analog, where LNA (locked nucleic acid) is a nucleic acid analog. LNA modification can be widely used in various fields, such as effective binding affinity with complementary sequences and stronger nuclease resistance than natural nucleotides, providing great potential for application in disease diagnosis and research. 2'-O,4'-C-Methyleneguanosine is a substrate for KOD DNA polymerase, which incorporates LNA-G nucleotides into growing DNA strands, including consecutive incorporations , to generate full-length extension products .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Research Areas:
PBD dimer-2 (compound 2c) is a C8-linked pyrrolobenzodiazepine dimer. PBD dimer-2 can span an extra base pair and cross-link the 5′-Pu-GA(T/A)TC-Py sequence. PBD dimer-2 can be used as a payload for antibody–agent conjugates (ADCs), and it can be used for the research of cancer .
Cat. No.: HY-P4076
CAS No.: 791642-10-9
Target:
Research Areas:
Cat. No.: HY-137697D
Purity: ≥98.0%
Research Areas:
ddCTP trilithium solution (100 mM) is a chain-terminating dideoxynucleotide. ddCTP trilithium is a type of chain-terminating deoxynucleotide. ddCTP trilithium can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP trilithium can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP trilithium is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .
Target:
Research Areas:
T7 RNA polymerase is a polymerase expressed by Escherichia coli from the RNA polymerase gene of T7 bacteriophage. T7 RNA polymerase is highly specific and involved in in vitro transcription (IVT) of mRNA. In the presence of Mg 2+, T7 RNA polymerase only uses the single-stranded or double-stranded DNA containing the T7 promoter sequence as a template, and uses NTP as a substrate to synthesize RNA complementary to the single-stranded DNA downstream of the promoter .
Cat. No.: HY-157549A
Synonyms: AYX1 sodium
Target:
Research Areas:
Brivoligide (AYX1) sodium is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide sodium can reduce acute post-surgical pain. Brivoligide sodium mimics the DNA sequence normally bound by EGR1 on chromosomes .
Cat. No.: HY-W591768
CAS No.: 68971-03-9
Target:
Research Areas:
(E)-4-(4-(Dimethylamino)styryl)-1-methylpyridin-1-ium (iodide) (Py-NMe2) is a styryl-based dye for fluorescence and CD-based sensing of various ds-DNA/RNA sequence. ( maxλAbs = 450 nm, maxλEm = 615 nm) .
Cat. No.: HY-107767
CAS No.: 81307-24-6
Synonyms: DC 81
Target:
Research Areas:
Antibiotic DC 81 (DC 81), an antitumor antibiotic produced by Streptomyces species, is a PBD (pyrrolo[2,1-c][1,4]benzodiazepine). Antibiotic DC 81 is potent inhibitor of nucleic acid synthesis. Antibiotic DC 81 can recognize and bind to specific sequences of DNA and form a labile covalent adduct .
Cat. No.: HY-106262
CAS No.: 949100-39-4
Synonyms: KAI-9803; BMS-875944
Target:
Research Areas:
Cat. No.: HY-137697
CAS No.: 66004-77-1
Cat. No.: HY-W001952
CAS No.: 15231-91-1
Cat. No.: HY-148947
CAS No.: 182873-67-2
Target:
Research Areas:
Cy5 Phosphoramidite is a fluorescent labeling reagent . Cy5 Phosphoramidite serves as a fluorescent tag for 3' terminal labeling of single-stranded DNA, enabling fluorescence-based nucleic acid detection, monitoring, quantification, and in vitro study .
Cat. No.: HY-160728
CAS No.: 1048021-78-8
Synonyms: 3′-O-Azidomethyl dATP
Target:
Research Areas:
3′-O-N3-dATP (3′-O-Azidomethyl dATP) is a modified nucleotide, which is utilized for DNA polymerase. 3′-O-N3-dATP acts as reversible terminator with enhanced raman scattering (SERS) at 2125 cm -1, which determines the DNA sequences continuously .
Cat. No.: HY-160226
Target:
Research Areas:
ISD (interferon stimulatory DNA) Control sodium is a non-immunostimulatory single-stranded oligonucleotide with the same sequence as ISD (HY-160225), its double-stranded counterpart . ISD Control can be used as a negative control for the CDS agonist ISD.
Cat. No.: HY-P1286
CAS No.: 172308-76-8
Target:
Research Areas:
Cat. No.: HY-P5429
CAS No.: 146064-85-9
Target:
Research Areas:
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
