Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
76 Results for "
RNA sequences
" in MedChemExpress (MCE) Product Catalog:
Products (76)
76 Results for "RNA sequences" in MCE Product Catalog:
12
12 Publications Verification
Synonyms: Phen-DC3 Triflate
Target:
Research Areas:
Phen-DC3 Trifluoromethanesulfonate is a bisquinolinium G-quadruplex (G4) ligand. Phen-DC3 Trifluoromethanesulfonate selectively binds to and stabilizes the hybrid quadruplex-duplex hybrid (QDH) derived from the PIM1 promoter. Phen-DC3 Trifluoromethanesulfonate also binds to the c-myc promoter Pu24T G4 via extensive π-stacking, and induces polymerase stalling at α-synuclein DNA and RNA G4 sequences. Phen-DC3 Trifluoromethanesulfonate downregulates LPS (HY-D1056)-induced TNFRSF21, RIPK3 and p-MLKL in VECs, and ameliorates CLP-induced pulmonary vascular leakage in septic rats. Phen-DC3 Trifluoromethanesulfonate can be used in studies related to neurodegenerative diseases and sepsis-associated vascular injury .
4
4 Cited Publications
Cat. No.: HY-106262B
Purity: 99.73%
Synonyms: KAI-9803 hydrochloride; BMS-875944 hydrochloride
Target:
Research Areas:
2
2 Cited Publications
Synonyms: 6-Methyladenosine (Standard); N-Methyladenosine (Standard)
1
1 Cited Publications
Research Areas:
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
1
1
Research Areas:
5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is a nucleoside phosphoramidite monomer used to synthesize locked nucleic acid (LNA) analog oligonucleotides. It can be used as a building block of antisense oligonucleotides (ASOs) to target complementary RNA sequences. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) locks the furanose ring into an N-type conformation through 2',4'-constrained ethyl (cEt) modification, enhancing hybridization affinity and mismatch discrimination with RNA, while significantly improving the resistance of oligonucleotides to exonuclease digestion. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) mediates RNase H-dependent mRNA degradation or inhibits translation by forming a stable hybrid with RNA, thereby achieving gene expression regulation. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is mainly used in the development of antisense drugs, gene function research and oligonucleotide synthesis related to disease treatment .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-173189
CAS No.: 65954-93-0
Synonyms: 2′,5′-ApApA; 2′,5′-trioligoadenylate; 5'-O-Triphosphoryladenylyl-(2'→5')-adenylyl-(2'→5')-adenosine
Target:
2-5A (2′,5′-ApApA) is a 5'-triphosphorylated (2',5') oligoadenylate. When covalently linked to an antisense molecule complementary to the target sequence, 2-5A activates RNase L, which subsequently degrades the target RNA bound to the 2-5A chimera. 2-5A can be used in research related to respiratory syncytial virus infection, colorectal adenocarcinoma and melanoma .
Cat. No.: HY-173189A
Synonyms: 2′,5′-ApApA pentasodium; 2′,5′-trioligoadenylate pentasodium; 5'-O-Triphosphoryladenylyl-(2'→5')-adenylyl-(2'→5')-adenosine pentasodium
Target:
2-5A pentasodium solution (100 mM) (2′,5′-ApApA pentasodium solution (100 mM)) is a 5'-triphosphorylated (2',5') oligoadenylate. When covalently linked to an antisense molecule complementary to the target sequence, 2-5A pentasodium solution (100 mM) activates RNase L, which subsequently degrades the target RNA bound to the 2-5A pentasodium solution (100 mM) chimera. 2-5A pentasodium solution (100 mM) can be used in research related to respiratory syncytial virus infection, colorectal adenocarcinoma and melanoma .
Target:
Research Areas:
rTRD01 is an orally active, specific TDP-43 binder that targets the RRM1 and RRM2 domains of TDP-43. rTRD01 partially disrupts the interaction between TDP-43 and c9orf72 repeat RNA, but does not affect the binding of TDP-43 to canonical binding sequences. rTRD01 exhibits significant neuroprotective effects in zebrafish models, improves motor function and protects against paraquat (a widely used herbicide)-induced neurodegeneration, with no teratogenicity at high concentrations. rTRD01 is not a general antioxidant and cannot counteract Rotenone (HY-B1756)-induced neuronal death. rTRD01 can be used to study amyotrophic lateral sclerosis and other TDP-43 proteinopathies .
Cat. No.: HY-148688
Purity: 96.25%
Target:
Research Areas:
ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .
Cat. No.: HY-137697D
Purity: ≥98.0%
Research Areas:
ddCTP trilithium solution (100 mM) is a chain-terminating dideoxynucleotide. ddCTP trilithium is a type of chain-terminating deoxynucleotide. ddCTP trilithium can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP trilithium can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP trilithium is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .
RGB-1 selectively binds to and stabilizes RNA G-quadruplex structures, and reduces the expression of the NRAS proto-oncogene in breast cancer cells. RGB-1 can serve as a tool for investigating the cellular functions of RNA G-quadruplex structures and identifying novel mRNA G-quadruplex-forming sequences. RGB-1 is applicable for breast cancer research .
Cat. No.: HY-153609
Purity: 92.51%
Research Areas:
AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
Target:
Research Areas:
T7 RNA polymerase is a polymerase expressed by Escherichia coli from the RNA polymerase gene of T7 bacteriophage. T7 RNA polymerase is highly specific and involved in in vitro transcription (IVT) of mRNA. In the presence of Mg 2+, T7 RNA polymerase only uses the single-stranded or double-stranded DNA containing the T7 promoter sequence as a template, and uses NTP as a substrate to synthesize RNA complementary to the single-stranded DNA downstream of the promoter .
Cat. No.: HY-177360
CAS No.: 3067915-73-2
Synonyms: RNA splicing modulator-4
Target:
Ruxuplam (RNA splicing modulator-4) is an RNA splicing modulator. Ruxuplam controls the inclusion or exclusion of specific exons in precursor mRNA (pre-mRNA) by regulating alternative splicing events, thereby altering the coding sequence and function of mature mRNA. Ruxuplam shows promise for research into neurodegenerative diseases (such as Huntington's disease) and cancers .
Cat. No.: HY-132590A
Purity: 93.16%
Synonyms: ALN-TTRSC sodium
Research Areas:
Revusiran (ALN-TTRSC) sodium is an RNA interference agent targeting the mRNA of transthyretin (Transthyretin, TTR). Revusiran sodium mediates sequence-specific degradation of TTR mRNA through RNA interference, reduces the synthesis of TTR protein, binds to GalNAc ligands, and is taken up by hepatocytes via the asialoglycoprotein receptor. Revusiran sodium exhibits favorable nonclinical safety profiles. Revusiran sodium can be used in studies related to transthyretin-mediated amyloidosis .
Cat. No.: HY-153843
Target:
Research Areas:
RNA Aptamer Corn (sodium) is a 28-nt-long aptamer that is substantially shorter than Spinach and Spinach2 and exhibits bright red fluorescence upon binding DFHO (a soluble analog of the intrinsic fluorophore of red fluorescent protein), RNA Aptamer Corn (sodium) can be used to visualize RNA expression or localization in live cells which have been soaked with chromophores. The Corn-DFHO does not become appreciably cytotoxic when illuminated. And most importantly, Corn-DFHO exhibits markedly increased photostability compared to other aptamer-chromophore complexes both in vitro and in vivo. (36 nt Corn construct: 5'-GGCGCGAGGAAGGAGGUCUGAGGAGGUCACUGCGCC-3'; A 36-nt RNA construct, comprised of the 28-nt minimal Corn sequence extended proximally with a 4 base-pair stem.)
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
