Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
9512 Results for "
targeted modification
" in MedChemExpress (MCE) Product Catalog:
Products (9512)
9512 Results for "targeted modification" in MCE Product Catalog:
5
5 Cited Publications
Target:
Research Areas:
EN6 is a small-molecule in vivo autophagy activator that covalently targets cysteine 277 in the ATP6V1A subunit of the lysosomal v-ATPase. EN6-mediated modification of ATP6V1A uncouples v-ATPase from Rag, leading to inhibition of mTORC1 signalling, increased lysosomal acidification, and activation of autophagy. EN6 also scavenges TDP-43 aggregates (causative agents of frontotemporal dementia) in a lysosome-dependent manner .
3
3 Cited Publications
Cat. No.: HY-W441014
DSPE-PEG2000-NHS is a PEG-modified phospholipid derivative that can be used to prepare liposomes. DSPE-PEG2000-NHS is commonly employed as a linker molecule for the surface modification of liposomes to confer targeting capabilities. DSPE-PEG2000-NHS can be used in the study of drug delivery .
3
3 Cited Publications
Research Areas:
DDO-2728 (compound 19) is a selective AlkB homologue 5 (ALKBH5) inhibitor with an IC50 of 2.97 μM. DDO-2728 increases the abundance of N 6 methyladenosine (m 6A) modifications, inducing cell apoptosis and cycle arrest. DDO-2728 suppresses tumor growth in the MV4 11 xenograft model with favorable safety profile, shows the potential of targeting ALKBH5 in cancer research .
3
3 Cited Publications
Cat. No.: HY-RI00449A
hsa-miR-21-5p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.
3
3 Cited Publications
Cat. No.: HY-P1291
CAS No.: 201422-03-9
Target:
Research Areas:
3
3 Cited Publications
Cat. No.: HY-P1291A
Target:
Research Areas:
2
2 Cited Publications
CNX-774 is an orally active, irreversible and selective BTK inhibitor, with an IC50 of < 1 nM. CNX-774 specifically targets Cysteine 481 of Btk for covalent modification .
1
1 Cited Publications
Cat. No.: HY-153084A
CD19 CAR mRNA (Human) expresses CAR protein that specifically targets human CD19. CD19 CAR mRNA can trigger transitory expression of CAR, allowing T cells to be targeted without permanent genetic modification. CD19 CAR mRNA targets CD19 which is a transmembrane glycoprotein primarily expressed on B lymphocytes and is important in B cell activation. CD19 CAR mRNA can be studied in cancer research such as lymphoma and leukemia .
1
1 Cited Publications
Synonyms: N3-Methyluridine
Target:
1
Target:
Research Areas:
1
1 Cited Publications
Cat. No.: HY-148775B
Purity: ≥95.0%
Target:
Research Areas:
PLGA-PEG-MAL (20KDA-5.0KDA, LA:GA RATIO 40:60) is a biodegradable amphipathic polymeric nanocarrier of poly (lactic-co-glycolic acid)-block-poly (ethylene glycol) (PLGA-PEG-Mal) that allows covalent modification of functional molecules. PLGA-PEG-MAL (20KDA-5.0KDA, LA:GA RATIO 40:60) modified with Angiopep-2 can cross the blood-brain barrier and exhibits targeting selectivity for glioblastoma cells. PLGA-PEG-MAL (20KDA-5.0KDA, LA:GA RATIO 40:60) can capture tumor-derived protein antigens, and exerts immunomodulatory effects when conjugated with anti-OX40 antibody; when used in combination with A2-CL/Dbait nanoparticles and radiotherapy, it prolongs survival time and reduces tumor volume in glioblastoma mouse models. PLGA-PEG-MAL (20KDA-5.0KDA, LA:GA RATIO 40:60) can be used for studies related to bacterial wound infections and glioblastoma .
Cat. No.: HY-W440911
Target:
Research Areas:
DSPE-PEG2000-Cy5 is a Cy5 (HY-D0821) fluorophore-labeled conjugate of distearoylphosphatidylethanolamine and polyethylene glycol, as well as a liposome component. The Cy5 fluorophore is commonly used for labeling proteins and nucleic acids in imaging, flow cytometry and genomic applications. DSPE-PEG2000-Cy5 supports cell membrane modification, in vivo tumor targeting research and long-term in vivo circulation of its liposomal formulations (Ex/Em=633/670 nm) .
ARS-1323-alkyne is a covalent inhibitor probe that covalently binds to the Switch-II pocket (S-IIP) of the KRAS G12C mutant protein. ARS-1323-alkyne visualizes the covalent modification of KRAS G12C and quantitatively measures the binding efficiency of the inhibitor to the target. ARS-1323-alkyne can be used to validate the target occupancy of KRAS G12C inhibitors and the synergistic mechanism of combination therapy .
Cat. No.: HY-119390
CAS No.: 1869921-96-9
Target:
Research Areas:
AA-CW236 is a MGMT (O6-methylguanine DNA methyltransferase) inhibitor. AA-CW236 targets MGMT active site Cys145 for covalent modification .
0 Images
CCTATAGGACTATCCAGGAA
Cat. No.: HY-153734
Purity: 92.18%
Cat. No.: HY-172351B
CAS No.: 24991-53-5
Cat. No.: HY-RI00057
hsa-miR-107 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
Cat. No.: HY-150655
CAS No.: 2252283-32-0
Hsp90-IN-15 is an Hsp90 inhibitor with anticancer activity. Hsp90-IN-15 induces cell apoptosis, arrests the cell cycle at S phase and decreases the expression level of Hsp90 in Hela cell .
Cat. No.: HY-133848
CAS No.: 83130-01-2
Synonyms: OK-135
Target:
Research Areas:
Alanycarb (OK-135) is a broad-spectrum oxime carbamate insecticide with contact and oral toxicity. Alanycarb is effective against a wide variety of insect pests and is a pro-insecticide. The principal active molecule produced by the biological modification of Alanycarb within target organisms is methomyl .
Cat. No.: HY-144187
CAS No.: 2755304-16-4
Target:
Research Areas:
PRMT5-IN-16 (Compound 20) is a PRMT5 inhibitor with anti-tumor activity. PRMT5 is a type of protein arginine methyltransferase, and is a new anti-tumor target related to epigenetic modification .
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
