2. Search Result
Search Result
Results for "

ASOs

" in MedChemExpress (MCE) Product Catalog:

41

Inhibitors & Agonists

1

Peptides

41

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-108764
    Mipomersen sodium
    2 Publications Verification

    ISIS 301012

    		 Apolipoprotein HCV Metabolic Disease
    Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
    Mipomersen sodium
  • HY-148503
    5'-ODMT cEt N-Bz A Phosphoramidite (Amidite)

    		Phosphoramidites Nucleoside Antimetabolite/Analog Others
    5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is a nucleoside phosphoramidite monomer used to synthesize locked nucleic acid (LNA) analog oligonucleotides. It can be used as a building block of antisense oligonucleotides (ASOs) to target complementary RNA sequences. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) locks the furanose ring into an N-type conformation through 2',4'-constrained ethyl (cEt) modification, enhancing hybridization affinity and mismatch discrimination with RNA, while significantly improving the resistance of oligonucleotides to exonuclease digestion. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) mediates RNase H-dependent mRNA degradation or inhibits translation by forming a stable hybrid with RNA, thereby achieving gene expression regulation. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is mainly used in the development of antisense drugs, gene function research and oligonucleotide synthesis related to disease treatment .
    5'-ODMT cEt N-Bz A Phosphoramidite (Amidite)
  • HY-136151
    UNC10217938A
    1 Publications Verification

    		 Nucleoside Antimetabolite/Analog Others
    UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .
    UNC10217938A
  • HY-147410
    Ulefnersen
    1 Publications Verification

    ION-363

    		 DNA/RNA Synthesis Neurological Disease
    Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
    Ulefnersen
  • HY-148130
    Rugonersen

    RG6091; RO7248824

    		 E1/E2/E3 Enzyme Others
    Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
    Rugonersen
  • HY-148687A
    SPC5001 sodium

    		PCSK9 Cardiovascular Disease
    SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sodium sequence: 5′-TGmCTACAAAACmCmCA-3′ .
    SPC5001 sodium
  • HY-132581
    Tadnersen
    1 Publications Verification

    BIIB078; IONIS-C9Rx

    		 Ras Others Neurological Disease
    Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Tadnersen
  • HY-157261
    UNC2383

    		Biochemical Assay Reagents Endocrinology
    UNC2383 is an oligonucleotide enhancer compound. UNC2383 can enhance the efficacy of antisense oligonucleotides (ASOs) and splice-switching oligonucleotides (SSOs). UNC2383 can be used in research of diseases involving impaired oligonucleotide delivery, such as cystic fibrosis .
    UNC2383
  • HY-145725A
    Baliforsen

    ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx

    		 Ser/Thr Kinase Neurological Disease
    Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .
    Baliforsen
  • HY-148688
    ASO 556089 sodium

    		DNA/RNA Synthesis Others
    ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .
    ASO 556089 sodium
  • HY-W048488
    2'-O-MOE-5-Me-rU

    		DNA/RNA Synthesis Drug Intermediate Others
    2'-O-MOE-5-Me-rU is a dual chemically modified ribonucleoside, which is a key modifying unit in the development of RNA drug preparations (such as antisense oligonucleotides ASO, siRNA). Its core function is to significantly enhance the stability, target affinity and drugability of nucleic acid drugs.
    2'-O-MOE-5-Me-rU
  • HY-W570887
    LNA-A(Bz) amidite

    		Phosphoramidites DNA/RNA Synthesis Others
    LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .
    LNA-A(Bz) amidite
  • HY-148370A
    Sefaxersen sodium

    IONIS-FB-LRx sodium; RG6299 sodium; ISIS 696844 sodium

    		 Complement System Others
    Sefaxersen sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). Sefaxersen sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
    Sefaxersen sodium
  • HY-148370
    Sefaxersen

    IONIS-FB-LRx; RG6299; ISIS 696844

    		 Complement System Others
    Sefaxersen (IONIS-FB-LRx) is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). Sefaxersen effectively reduces circulating levels of CFB. Sefaxersen can be used for geographic atrophy (GA) research .
    Sefaxersen
  • HY-W570885
    2'-O-MOE-rC

    		Phosphoramidites DNA/RNA Synthesis Others
    2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
    2'-O-MOE-rC
  • HY-158827A
    AZD8233 sodium

    		PCSK9 Metabolic Disease
    AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
    AZD8233 sodium
  • HY-137501
    306-O12B-3

    		Liposome Others
    306-O12B-3 is a lipidoid that can efficiently deliver ASO both in vitro and in vivo. 306-O12B-3 is used to transport small molecule drugs across the blood-brain barrier (BBB) .
    306-O12B-3
  • HY-132582A
    Tau ASO-12 (murine) sodium

    		Tau Protein Cancer
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) sodium
  • HY-147410A
    Ulefnersen sodium
    1 Publications Verification

    ION-363 sodium

    		 DNA/RNA Synthesis Neurological Disease
    Ulefnersen sodium (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen sodium can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen sodium can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
    Ulefnersen sodium
  • HY-132581E
    Scrambled Tadnersen

    Scrambled BIIB078; Scrambled IONIS-C9Rx

    		 Ras Neurological Disease
    Scrambled Tadnersen is the Negative Control of Tadnersen sodium (HY-132581A). Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Scrambled Tadnersen
  • HY-132581A
    Tadnersen sodium
    1 Publications Verification

    BIIB078 sodium; IONIS-C9Rx sodium

    		 Ras Neurological Disease
    Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Tadnersen sodium
  • HY-159695A
    IONIS-GCCRRx sodium

    ISIS 426115 sodium

    		 Glucocorticoid Receptor Metabolic Disease
    IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
    IONIS-GCCRRx sodium
  • HY-148130A
    Rugonersen sodium

    RG6091 sodium; RO7248824 sodium

    		 E1/E2/E3 Enzyme Others
    Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
    Rugonersen sodium
  • HY-148687
    SPC5001

    		PCSK9 Cardiovascular Disease
    SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
    SPC5001
  • HY-177615A
    Apazunersen sodium

    GTX-102 sodium

    		 E1/E2/E3 Enzyme Others
    Apazunersen sodium is an antisense oligonucleotide (ASO) that targets and inhibits expression of the UBE3A antisense transcript (UBE3A-AS) to prevent silencing of the paternally inherited allele of the UBE3A gene and reactivate expression of the deficient
    Apazunersen sodium
  • HY-177615
    Apazunersen

    GTX-102

    		 E1/E2/E3 Enzyme Others
    Apazunersen is an antisense oligonucleotide (ASO) that targets and inhibits expression of the UBE3A antisense transcript (UBE3A-AS) to prevent silencing of the paternally inherited allele of the UBE3A gene and reactivate expression of the deficient protei
    Apazunersen
  • HY-177616
    Archexin

    RX-0201

    		 Akt Cancer
    Archexin is an antisense oligonucleotide (ASO) against Akt1. It is used for the study of metastatic renal cancer.
    Archexin
  • HY-159695
    IONIS-GCCRRx

    ISIS 426115

    		 Glucocorticoid Receptor Metabolic Disease
    IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
    IONIS-GCCRRx
  • HY-122740
    Retro-1

    		Bacterial Infection
    Retro-1 is a toxin inhibitor. Retro-1 blocks the retrograde transport of STxB to the trans-Golgi network/Golgi. Retro-1 inhibits the cytotoxic effects of Ricin, bacterial toxins Stx1 and Stx2. Retro-1 can also substantially enhance the effectiveness of antisense and splice switching oligonucleotides .
    Retro-1
  • HY-132581C
    Scrambled Tadnersen sodium

    Scrambled BIIB078 sodium; Scrambled IONIS-C9Rx sodium

    		 Ras Neurological Disease
    Scrambled Tadnersen sodium is the Negative Control of Tadnersen sodium (HY-132581A). Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Scrambled Tadnersen sodium
  • HY-158825
    Cepadacursen sodium

    CIVI007 sodium

    		 PCSK9 Metabolic Disease
    Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia research and the prevention of atherosclerotic cardiovascular disease (ASCVD).
    Cepadacursen sodium
  • HY-158827
    AZD8233

    		PCSK9 Metabolic Disease
    AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
    AZD8233
  • HY-177616A
    Archexin sodium

    RX-0201 sodium

    		 Akt Cancer
    Archexin sodium is an antisense oligonucleotide (ASO) against Akt1. It is used for the study of metastatic renal cancer.
    Archexin sodium
  • HY-132582H
    FAM labled Tau ASO-12 (murine) sodium

    		Fluorescent Dye Cancer
    FAM labled Tau ASO-12 (murine) sodiumis a FAM labled Tau ASO-12 (murine) sodium.
    FAM labled Tau ASO-12 (murine) sodium
  • HY-132582I
    Cy3 labled Tau ASO-12 (murine) sodium

    		Fluorescent Dye Cancer
    Cy3 labled Tau ASO-12 (murine) sodium is a Cy3 labled Tau ASO-12 (murine) sodium.
    Cy3 labled Tau ASO-12 (murine) sodium
  • HY-132582E
    Tau ASO-12 (murine) sodium scrambled negative control

    		Tau Protein Cancer
    Tau ASO-12 (murine) sodium scrambled negative control is the sequence scrambled negative control of Tau ASO-12 (murine) sodium.
    Tau ASO-12 (murine) sodium scrambled negative control
  • HY-148688D
    FAM labled ASO 556089 sodium

    		Fluorescent Dye Others
    FAM labled ASO 556089 sodiumis a FAM labled ASO 556089 sodium.
    FAM labled ASO 556089 sodium
  • HY-148688E
    Cy3 labled ASO 556089 sodium

    		Fluorescent Dye Others
    Cy3 labled ASO 556089 sodium is a Cy3 labled ASO 556089 sodium.
    Cy3 labled ASO 556089 sodium
  • HY-148688C
    ASO 556089 sodium scrambled negative control

    		DNA/RNA Synthesis Others
    ASO 556089 sodium scrambled negative control is the sequence scrambled negative control of ASO 556089 sodium.
    ASO 556089 sodium scrambled negative control
  • HY-158830B
    FAM labled MDM4-targeting ASO sodium

    		Fluorescent Dye Cancer
    FAM labled MDM4-targeting ASO sodiumis a FAM labled MDM4-targeting ASO sodium.
    FAM labled MDM4-targeting ASO sodium
  • HY-158830C
    Cy3 labled MDM4-targeting ASO sodium

    		Fluorescent Dye Cancer
    Cy3 labled MDM4-targeting ASO sodium is a Cy3 labled MDM4-targeting ASO sodium.
    Cy3 labled MDM4-targeting ASO sodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: