Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
46 Results for "
ASOs
" in MedChemExpress (MCE) Product Catalog:
Products (46)
46 Results for "ASOs" in MCE Product Catalog:
3
Target:
Research Areas:
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
1
1 Cited Publications
Target:
Research Areas:
UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .
1
Target:
Research Areas:
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
1
Research Areas:
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
1
1 Cited Publications
Synonyms: ION-363 sodium
Target:
Research Areas:
Ulefnersen sodium (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen sodium can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen sodium can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
1
1 Cited Publications
Cat. No.: HY-132581A
Purity: 90.06%
Synonyms: BIIB078 sodium; IONIS-C9Rx sodium
Target:
Research Areas:
Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
Research Areas:
5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is a nucleoside phosphoramidite monomer used to synthesize locked nucleic acid (LNA) analog oligonucleotides. It can be used as a building block of antisense oligonucleotides (ASOs) to target complementary RNA sequences. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) locks the furanose ring into an N-type conformation through 2',4'-constrained ethyl (cEt) modification, enhancing hybridization affinity and mismatch discrimination with RNA, while significantly improving the resistance of oligonucleotides to exonuclease digestion. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) mediates RNase H-dependent mRNA degradation or inhibits translation by forming a stable hybrid with RNA, thereby achieving gene expression regulation. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is mainly used in the development of antisense drugs, gene function research and oligonucleotide synthesis related to disease treatment .
Synonyms: RG6091; RO7248824
Target:
Research Areas:
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
Cat. No.: HY-148687A
Purity: 93.97%
Target:
Research Areas:
SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sodium sequence: 5′-TGmCTACAAAACmCmCA-3′ .
Target:
Research Areas:
UNC2383 is an oligonucleotide enhancer compound. UNC2383 can enhance the efficacy of antisense oligonucleotides (ASOs) and splice-switching oligonucleotides (SSOs). UNC2383 can be used in research of diseases involving impaired oligonucleotide delivery, such as cystic fibrosis .
Cat. No.: HY-145725A
CAS No.: 1698048-23-5
Synonyms: ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx
Target:
Research Areas:
Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .
Cat. No.: HY-148688
Purity: 96.25%
Target:
Research Areas:
ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .
Cat. No.: HY-W048488
CAS No.: 163759-49-7
Target:
Research Areas:
2'-O-MOE-5-Me-rU is a dual chemically modified ribonucleoside, which is a key modifying unit in the development of RNA drug preparations (such as antisense oligonucleotides ASO, siRNA). Its core function is to significantly enhance the stability, target affinity and drugability of nucleic acid drugs.
Synonyms: IONIS-FB-LRx sodium; RG6299 sodium; ISIS 696844 sodium
Target:
Research Areas:
Sefaxersen sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). Sefaxersen sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
Cat. No.: HY-W570885
CAS No.: 251647-54-8
Target:
Research Areas:
2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
Cat. No.: HY-148370
CAS No.: 2272975-74-1
Synonyms: IONIS-FB-LRx; RG6299; ISIS 696844
Target:
Research Areas:
Sefaxersen (IONIS-FB-LRx) is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). Sefaxersen effectively reduces circulating levels of CFB. Sefaxersen can be used for geographic atrophy (GA) research .
Cat. No.: HY-158827A
Target:
Research Areas:
AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
Cat. No.: HY-132582A
Purity: 94.68%
Target:
Research Areas:
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
Cat. No.: HY-132581E
Synonyms: Scrambled BIIB078; Scrambled IONIS-C9Rx
Target:
Research Areas:
Scrambled Tadnersen is the Negative Control of Tadnersen sodium (HY-132581A). Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
