Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
64 Results for "
bases
" in MedChemExpress (MCE) Product Catalog:
Products (64)
64 Results for "bases" in MCE Product Catalog:
Cat. No.: HY-N10706A
CAS No.: 35299-94-6
Target:
Research Areas:
3-Keto sphinganine (d18:0) hydrochloride serves as the substrate for 3-keto-dihydrosphingosine reductase in the de novo sphingolipid synthesis pathway, and is a key intermediate in the de novo synthesis of sphingoid long-chain bases. 3-Keto sphinganine (d18:0) hydrochloride can be used in studies related to thrombocytopenia, anemia .
Target:
Research Areas:
Lactosylceramide (bovine buttermilk) (LacCer (bovine buttermilk)) is a natural lactosylceramide (LacCer) mixture derived from bovine buttermilk, belonging to neutral glycosphingolipids, and composed of a lactose polar head group and a ceramide backbone. LacCer is an important component of cell membrane glycosphingolipids and is associated with processes such as signal transduction, cell recognition, cell adhesion, and cell growth. LacCer derived from bovine buttermilk contains multiple molecular species composed of different long-chain bases and fatty acyl groups. Lactosylceramide (bovine buttermilk) can be used for research related to lactosylceramide and glycosphingolipids .
Cat. No.: HY-W013677
CAS No.: 456-22-4
Cat. No.: HY-I0626S2
CAS No.: 106391-24-6
Cat. No.: HY-W002593
CAS No.: 49669-13-8
Cat. No.: HY-I0626S1
CAS No.: 181517-10-2
0 Images
CCTATAGGACTATCCAGGAA
Cat. No.: HY-153734
Purity: 92.18%
Target:
Cat. No.: HY-W046786
CAS No.: 1217-89-6
Target:
Research Areas:
Benzylisatin is a biologically potent derivative of isatin. Benzylisatin is used to prepare many new biologically potent Schiff bases and complexes suitable for medicinal purposes .
Cat. No.: HY-W142631
CAS No.: 101-75-7
Cat. No.: HY-I0626S
CAS No.: 285978-06-5
Cat. No.: HY-134529
CAS No.: 14075-00-4
Synonyms: Ribose 1-phosphate
Category:
Human Gut Microbiota Metabolites Natural Products Other Diseases Endogenous metabolite Disease Research Fields
Target:
Target:
Research Areas:
Purine nucleoside phosphorylase, Bacillus sp. is a key enzyme in purine metabolism, involved in the purine salvage pathway. A deficiency in Purine nucleoside phosphorylase, Bacillus sp. can lead to impaired T-cell function. In the presence of inorganic phosphate as a second substrate, Purine nucleoside phosphorylase, Bacillus sp. catalyzes the cleavage of the glycosidic bond of ribonucleosides and deoxyribonucleosides, producing purine bases and ribose (or deoxyribose)-1-phosphate. Purine nucleoside phosphorylase, Bacillus sp. can be used for the determination of inorganic phosphate .
Cat. No.: HY-113110R
CAS No.: 19246-18-5
Synonyms: L-Cysteinylglycine (Standard); Cys-Gly (Standard); H-Cys-Gly-OH (Standard)
Cat. No.: HY-112501
CAS No.: 1338233-09-2
Target:
Research Areas:
Codon readthrough inducer 1, containing pyrimidine bases, shows good readthrough activity.
Cat. No.: HY-N1567
CAS No.: 38072-88-7
Target:
Cat. No.: HY-W008469R
CAS No.: 700-49-2
Target:
Research Areas:
2-Fluoroadenine is a toxic purine bases. 2-Fluoroadenine has toxicity in nonproliferating and proliferating tumor cells. 2-Fluoroadenine can be used for researching anticancer .
Cat. No.: HY-E70023
CAS No.: 170347-55-4
Target:
Research Areas:
Sphingolipid ceramide N-deacylase (SCDase) cleaves the N-acyl linkage between fatty acids and sphingosine bases in various glycosphingolipids. Sphingolipid ceramide N-deacylase catalyzes glycosphingolipids to lysoglycosphingolipids .
Cat. No.: HY-D1757
CAS No.: 161578-11-6
Synonyms: LYen; PAsp- LY
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
