Copy Link Print Information

SiRNA Negative Control

27 Cited Publications
Revisión del cliente

Based on 27 publication(s) in Google Scholar

SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. SiRNA Negative Control has no homology to most known gene sequence. SiRNA Negative Control can be used in human, mouse and rat cells in vitro. SiRNA Negative Control can be used as experimental control benchmark, verification of experimental reliability and standardization reference. SiRNA Negative Control is a common negative control used in most research articles.

Para uso exclusivo en investigación. No vendemos a pacientes.

  • Pureza: 99.24%
  • Peso molecular:13323.03
  • Almacenamiento:

    -20°C, sealed storage, away from moisture

    * In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

  • SiRNA Negative Control Chemical Structure
    SiRNA Negative Control Chemical Structure
  • Experimental Validation Results for SiRNA Negative Control
  • Experimental Validation Results for SiRNA Negative Control
  • Experimental Validation Results for SiRNA Negative Control
  • Experimental Validation Results for SiRNA Negative Control
  • Experimental Validation Results for SiRNA Negative Control
Tamaño
Precio
Stock
Cantidad
Amount: USD 0.00
Please select quantity
or
or

* Seleccione Cantidad antes de agregar artículos.

To place orders, for customer services and technical support, please contact: MedChemExpress USA

Tel: 609-228-6898 E-mail: [email protected] [email protected]

Data Download
Other Forms of SiRNA Negative Control:

To place orders, for customer services and technical support, please contact:

609-228-6898
[email protected] [email protected]
Encuentre su distribuidor local Your local distributor: Hycultec GmbHHycultec
  • Actividad biológica
  • Chemical Information
  • Solvente y solubilidad
  • Pureza y Documentación
  • Help & FAQs
Top Publications Citing

Use of MCE Products

Publications Citing Use of MedChemExpress (MCE) SiRNA Negative Control

More
Customer Validation & Images
Flow CytometryRT-PCRWBCell Proliferation/Viability AssayCell Imaging/Staining
  • Flow Cytometry
  • WB
  • Cell Imaging/Staining
  • RT-PCR
  • Cell Proliferation/Viability Assay
Keywords
MOQ
Minimum order quantity
100 mg

Obtener un presupuesto En stock

Other size
Obtener un presupuesto
Please select quantity
Amount: USD 0.00
Sign in to MedChemExpress Inicie sesiòn
Registrar
Sign in to MedChemExpress
Registrar una cuenta nueva

At least 6 characters

Personalize your experience, you are currently not signed in. For a better experience, please create an online profile, you can:

Obtain points redemption prizes
Check out faster
Add multiple shipping locations
View orders
Assay Types
  • SiRNA Negative Control Chemical Structure
    SiRNA Negative Control Chemical Structure RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1)
    1/16
  • 1/16

    SiRNA Negative Control purchased from MedChemExpress. Usage Cited in: Mol Med. 2025 Sep 29;31(1):307. [Abstract]

    Customer Validation
     SiRNA Negative Control (Si-NC)- or si-Miro1-transfected mGFP-EPO-BM-MSCs (showing a green fluorescence) were co-cultured with mtCC1-2 cells labeled with CellTrace Violet (showing a blue fluorescence). Flow cytometry analyzed the percentage of mtCC1-2 cells labeled with GFP and CellTrace Violet.

  • 1/16

    SiRNA Negative Control purchased from MedChemExpress. Usage Cited in: Mol Med. 2025 Sep 29;31(1):307. [Abstract]

    Customer Validation
     Immunoblotting of M-sec in SiRNA Negative Control (Si-NC)- or si-M-sec-transfected EPO-BM-MSCs.

  • 1/16

    SiRNA Negative Control purchased from MedChemExpress. Usage Cited in: Mol Med. 2025 Sep 29;31(1):307. [Abstract]

    Customer Validation
     Fluorescence microscopy and the percentage of TNT-forming cells between SiRNA Negative Control (si-NC)-transfected EPO-BM-MSCs or si-M-sec-transfected EPO-BM-MSCs.

  • 1/16

    SiRNA Negative Control purchased from MedChemExpress. Usage Cited in: Ann Hepatol. 2025 Jan 3:101776. [Abstract]

    Customer Validation
     Expression of PFKM mRNA transcript in MHCC97 and Huh-7 HCC cells transfected with SiRNA Negative Control (si-NC) or si-METTL16 (the 1:1 ratio mix of si-METTL16#1:si-METTL16#3) by quantitative PCR (n = 3).

  • 1/16

    SiRNA Negative Control purchased from MedChemExpress. Usage Cited in: Ann Hepatol. 2025 Jan 3:101776. [Abstract]

    Customer Validation
     SiRNA Negative Control (si-NC) (48 h). CCK-8 cell viability assay in transfected MHCC97 and Huh-7 HCC cells.

  • RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA, (ACGUGACACGUUCGGAGAAUU) (1:1)