Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
10028 Results for "
pyroglutamate modification
" in MedChemExpress (MCE) Product Catalog:
Products (10028)
10028 Results for "pyroglutamate modification" in MCE Product Catalog:
1
Category:
Alkaloids Human Gut Microbiota Metabolites Neurological Disease Other Alkaloids Endogenous metabolite Disease Research Fields Cancer
Target:
1
1 Cited Publications
Cat. No.: HY-B0515B
CAS No.: 138844-81-2
Target:
Research Areas:
Ibandronate Sodium is an orally active, selective inhibitor of farnesyl pyrophosphate synthase (FPP synthase). Ibandronate Sodium can block the mevalonate pathway to inhibit the isoprenylation modification of small GTPases (such as RAS, RHO family proteins), induce tumor cell apoptosis and inhibit bone resorption. Ibandronate Sodium inhibits tumor cell proliferation (such as ER+ breast cancer cells), promotes the expression of the pro-apoptotic gene FAS, and can produce synergistic anti-tumor effects with anti-estrogen compounds. Ibandronate Sodium is used in the study of osteoporosis and bone metastatic tumors (such as breast cancer bone metastasis) .
Cat. No.: HY-P99859
CAS No.: 1931944-80-7
Synonyms: LY3002813
Target:
Research Areas:
Synonyms: Biotinamidocaproyl hydrazide; BACH; (+)-Biotinamidohexanoic Acid hydrazide; Biotin Aminocaproyl Hydrazide
Cat. No.: HY-140651
Purity: ≥93.0%
Target:
Research Areas:
Amine-PEG2000-thiol is a conjugate containing amino, PEG and thiol groups, used for drug delivery, material modification and chemical synthesis.
Cat. No.: HY-166990
CAS No.: 99126-64-4
Synonyms: MeO-PEG5000-Mal
Cat. No.: HY-32290
CAS No.: 54571-66-3
Synonyms: (S)-Methyl 5-oxopyrrolidine-2-carboxylate; L-Pyroglutamic acid methyl ester
Target:
Research Areas:
Methyl L-pyroglutamate ((S)-Methyl 5-oxopyrrolidine-2-carboxylate) is a phenolic compound. Methyl L-pyroglutamate can be isolated from Portulaca oleracea L. Methyl L-pyroglutamate slightly inhibits NO production. Methyl L-pyroglutamate can be used in the research of inflammatory diseases .
Cat. No.: HY-148389
CAS No.: 68141-38-8
Synonyms: Sialylglycoasparaginate
Target:
Research Areas:
Disialo-Asn (Sialylglycoasparaginate) is an asparagine oligosaccharide. Disialo-Asn can be used for nucleic acid modification .
Cat. No.: HY-167837
CAS No.: 27696-41-9
Synonyms: 8-Hydroxyluteolin
Category:
Target:
Target:
Research Areas:
Pentynoic acid STP ester sodium is a click chemistry reagent containing a terminal propargyl group and a STP ester group. Pentynoic acid STP ester sodium is suitable for protein modification .
Cat. No.: HY-W013741
CAS No.: 2491-17-0
Target:
Research Areas:
N-benzoyl-L-aspartic acid, a major metabolite of benzyl glucosinolate, can be used for modification of peptides or proteins .
Cat. No.: HY-19804
CAS No.: 1863117-91-2
Synonyms: Photo lysine
Cat. No.: HY-P4885
CAS No.: 161818-04-8
Synonyms: AβpE3-40
Target:
Research Areas:
Cat. No.: HY-W114327
CAS No.: 113886-71-8
Target:
Research Areas:
N4-Acetyl-2'-O-methylcytidine (ac4Cm) is an RNA with dual acetylation and methoxidation modifications found in thermophilic archaea. N4-Acetyl-2'-O-methylcytidine has been implicated in the adaptability of archaea in extreme environments, enhancing RNA stability through dual modification .
Cat. No.: HY-131481
CAS No.: 32860-54-1
Category:
Target:
5'-O-DMT-N4-Bz-2'-F-dC is a nucleoside with protective and modification effects.
Target:
Research Areas:
Pyroglutamate aminopeptidase I is a type of enzyme that cleaves the peptide bond of pyroglutamic acid linked to the N-terminal end of a protein, including some important anti-inflammatory proteins like immunoglobulin .
0 Images
CCTATAGGACTATCCAGGAA
Cat. No.: HY-153734
Purity: 92.18%
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
