2. Signaling Pathways
  3. Neuronal Signaling
  4. Tau Protein

Tau Protein

Tau is well established as a microtubule-associated protein in neurons. They have roles primarily in maintaining the stability of microtubules in axons and are abundant in the neurons of the central nervous system (CNS). However, under pathological conditions, aberrant assembly of tau into insoluble aggregates is accompanied by synaptic dysfunction and neural cell death in a range of neurodegenerative disorders, collectively referred to as tauopathies.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-B1239
    Drofenine hydrochloride
    		98.10%
    Drofenine (Cycloadiphene; Hexahydroadiphenine) hydrochloride is an brain-penetrant antispasmodic agent. Drofenine hydrochloride is a Kv2.1 channel inhibitor with human IC50 of 9.53 μM. Drofenine hydrochloride is a butyrylcholinesterase (BChE) inhibitor with Ki of 0.003 mM, and is a TRPV3 activator. Drofenine hydrochloride blocks Kv2.1-dependent potassium efflux, inhibits Kv2.1/JNK/NF-κB and IkBa/NF-kB signaling, suppresses Kv2.1 mRNA/protein expression. Drofenine suppresses oligomeric Aβ-induced microglial NLRP3 inflammasome activation and neuronal Tau hyperphosphorylation, improves cognitive impairment, promotes neurite outgrowth. Drofenine hydrochloride induces calcium influx in keratinocytes and exert cytotoxicity against keratinocytes. Drofenine hydrochloride ameliorates diabetic peripheral neuropathy -like pathology. Drofenine hydrochloride can be used for the researches of Alzheimer's disease, diabetic peripheral neuropathy and smooth muscle spasm.
    Drofenine hydrochloride
  • HY-P1707A
    Tau protein (592-597), human TFA
    Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia.
    Tau protein (592-597), human TFA
  • HY-175552
    CHIPOpt
    		Inhibitor 99.49%
    CHIPOpt, a peptide, is an orthosteric CHIP TPR domain inhibitor with a Kd of ∼16 nM. CHIPOpt has anti-aggregation activity and decreases p.tau ubiquitination with little effect on unmodified tau. CHIPOpt can be used for Alzheimer’s disease research.
    CHIPOpt
  • HY-P991480
    ONC-841
    		Inhibitor
    ONC-841 is a blood-brain barrier-permeable, humanized monoclonal antibody targeting SIGLEC10. As an immune checkpoint inhibitor, ONC-841 restores the functions of immune effector cells such as T cells and enhances anti-tumor immune responses by blocking inhibitory signals mediated by SIGLEC10. ONC-841 restores the phagocytic and migratory activities of microglia, and promotes the phagocytosis of Amyloid-β and Tau protein aggregates by microglia. ONC-841 is applicable to research related to solid tumors and Alzheimer's disease.
    ONC-841
  • HY-128879A
    VP3.15 dihydrobromide
    		Inhibitor 98.0%
    VP3.15 dihydrobromide is a highly potent, orally bioavailable, and CNS-penetrant PDE7-GSK3 dual inhibitor, with IC50 values of 1.59 μM and 0.88 μM against PDE7 and GSK3, respectively. VP3.15 dihydrobromide elevates intracellular cAMP levels, suppresses immune responses, enhances remyelination, limits excessive tau phosphorylation, and alleviates neuroinflammation and neuronal loss. VP3.15 dihydrobromide promotes oligodendrocyte precursor cell differentiation, improves in vivo remyelination, inhibits autoimmune encephalomyelitis, and mitigates germinal matrix-intraventricular hemorrhage-related brain injury, cerebral atrophy, ventricular enlargement, and cognitive impairment. VP3.15 dihydrobromide can be used in research related to multiple sclerosis and germinal matrix-intraventricular hemorrhage.
    VP3.15 dihydrobromide
  • HY-W143216
    Azure C
    		Inhibitor
    Azure C acts as a tau oligomer modulator and Aβ42 oligomerization inhibitor. It regulates hsp70 ATPase activity, thereby mediating the clearance of tau protein. Azure C reduces the levels of toxic tau oligomers by promoting the formation of non-toxic tau aggregates, rescues neuroblastoma cells from tau oligomer-induced toxicity, and binds to and inhibits Aβ42 oligomerization without suppressing its fibrillization. Azure C is generated via sequential oxidation of methylene blue or Azure B through a horseradish peroxidase-mediated reaction, and accumulates in HRP reaction media. Azure C can be used in studies related to tauopathies, including Alzheimer's disease.
    Azure C
  • HY-156585
    CNS-11
    		Inhibitor 98.30%
    CNS-11 is a brain-penetrant tau fibril-degrading compound. CNS-11 reduces α-synuclein. CNS-11 can be used in Alzheimer's and Parkinson's disease research.
    CNS-11
  • HY-176438
    DDL-357
    		Inhibitor 98.31%
    DDL-357 is a potent secreted clusterin enhancer. DDL-357 reduces phospho-tau in brain and improves memory in the murine 3xTg-AD model.
    DDL-357
  • HY-139142
    Simufilam
    		Inhibitor 99.78%
    Simufilam (PTI-125) is an orally active FLNA modulator. Simufilam restores NMDAR signaling and Arc expression. Simufilam inhibits overactive mTOR signaling by restoring the normal conformation of FLNA, improves insulin sensitivity, reduces Aβ42-induced neuroinflammation and tau protein hyperphosphorylation. Simufilam can be used for research of Alzheimer's disease.
    Simufilam
  • HY-137557
    Florzolotau
    		Ligand
    Florzolotau (APN1607) is a positron emission tomography (PET) ligand that can be used for the detection of Alzheimer's disease (AD) and other tau proteinopathies. Its binding sites are located in the β-sheet of paired helical filaments (PHFs) and straight filaments (SFs) of tau protein, as well as in the C-shaped cavity of SFs. In addition, APN-1607 binds to intraneuronal inclusions in Alzheimer's disease (AD), primary age-related tauopathy (PART) and posterior cortical atrophy (PCA). Florzolotau shows promise for PET imaging studies of neurological disorders, particularly tau proteinopathies.
    Florzolotau
  • HY-154851
    GSK-3 inhibitor 3
    		Inhibitor 99.10%
    GSK-3 inhibitor 3 is a selective, orally active and brain-penetrant inhibitor of GSK-3, with IC50s of 0.35 nM and 0.25 nM for GSK-3α and GSK-3β, respectively. GSK-3 inhibitor 3 lowers levels of tau protein phosphorylation at S396 in a triple-transgenic mouse Alzheimer’s disease model, with IC50 of 10 nM. GSK-3 inhibitor 3 can be used for neurological disease research.
    GSK-3 inhibitor 3
  • HY-10863S
    Anandamide-d8
    		Inhibitor 99.90%
    Anandamide-d8 is a deuterated labeled Anandamide. Anandamide is an endocannabinoid. Anandamide modulates both neuronal and immune functions through two protein-coupled cannabinoid receptors (CB1 and CB2). Anandamide can activate numerous other receptors like PPARS, TRPV1, and GPR18/GPR55. Anandamide also has potential anti-fungal and anti-inflammatory activities. Anandamide can be used for the research of Alzheimer’s disease (AD) and ulcerative colitis.
    Anandamide-d<sub>8</sub>
  • HY-132582D
    Diranersen scramble control
    		Control 98.99%
    Scrambled IONIS-MAPTRx (sodium) is a scrambled sequence of IONIS-MAPTRx sodium (HY-132582C). Scrambled IONIS-MAPTRx (sodium) has the same amino acid composition as the active IONIS-MAPTRx sodium fragment, but the sequence is randomly scrambled. Scrambled IONIS-MAPTRx (sodium) is typically used as a negative control. Scrambled IONIS-MAPTRx (sodium) has potential for studying Alzheimer's disease.
    Diranersen scramble control
  • HY-141660
    BSc3094
    		98.86%
    BSc3094 is a Tau aggregation inhibitor. BSc3094 can be used for the research of Alzheimer's disease (AD).
    BSc3094
  • HY-P991373
    APNmAb005
    		Inhibitor
    APNmAb005 is a human monoclonal antibody (mAb) targeting MAPT/Tau/PHF-tau. APNmAb005 blocks tau seeding in vitro and rescues neuronal loss in rTG4510 mice. APNmAb005 can be used in Alzheimer’s disease (AD) research.
    APNmAb005
  • HY-132582A
    Tau ASO-12 (murine) sodium
    		Inhibitor
    TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) sodium
  • HY-162750
    ZJCK-6-46
    		Inhibitor 99.06%
    ZJCK-6-46 (32) is a potential and orally activeDYRK1A inhibitor (IC50 = 0.68 nM) with high BBB permeability (CNS+). ZJCK-6-46 (32) reduces tau phosphorylation. ZJCK-6-46 (32) ameliorates cognitive dysfunction by obviously reducing the expression of phosphorylated tau and neuronal loss in vivo.
    ZJCK-6-46
  • HY-101185
    T808
    		Ligand 98.20%
    T808 is a selective tau protein-targeting ligand. T808 can be used to synthesize [18F]-T808, a highly selective tau protein positron emission tomography (PET) tracer. T808 can also be used to synthesize [3H]-T808, a marker for in vitro experiments. T808 can be used for the research of alzheimer’s disease.
    T808
  • HY-19738
    NQTrp
    		Inhibitor 98.37%
    NQTrp, an aromatic naphthoquinone-tryptophan hybrid molecule, an inhibitor of the aggregation of the tau protein with generic anti-amyloidogenic effects. NQTrp inhibits the in vitro aggregation of hexapeptide (41GCWMLY46 within the N-terminus of γD-crystallin) as well as full-length γD-crystallin.
    NQTrp
  • HY-121811
    Pongamol
    		Inhibitor 99.81%
    Pongamol (Lanceolatin C) is an orally active flavonoid with an IC50 of 75 μM and a Ki of 58 μM against PTPase-1B, and an IC50 of 103.5 μM against intestinal α-Glycosidase. Pongamol reduces the release of IL‑1β, TNF‑α, COX‑2 and iNOS in cells, reverses the nuclear translocation of NF‑κB, and upregulates the levels of Beclin 1 and LC3 Ⅱ/LC3 Ⅰ. Pongamol promotes glucose uptake by increasing the level of GLUT4 on the surface of skeletal muscle cells. Pongamol inhibits epithelial-mesenchymal transition by suppressing the FAK/Akt-mTOR signaling pathway. Pongamol inhibits neuronal cytotoxicity, suppresses cell apoptosis and extends the lifespan of Caenorhabditis elegans by activating the MAPKs/Nrf2 signaling pathway. Pongamol exerts hypoglycemic effects in diabetic mouse models. Pongamol exhibits antibacterial activity. Pongamol alleviates oxidative stress, neuroinflammation, Aβ deposition and excessive phosphorylation of Tau Protein, and restores autophagy function in Alzheimer's disease mouse models by inhibiting the Akt/mTOR signaling pathway. Pongamol is applicable to research related to Alzheimer's disease, type 2 diabetes, non-small cell lung cancer and postprandial hyperglycemia.
    Pongamol
Cat. No. Product Name / Synonyms Application Reactivity