95 Results for "

RNA oligonucleotides

" in MedChemExpress (MCE) Product Catalog:
Products (95)

95 Results for "RNA oligonucleotides" in MCE Product Catalog:

7
7 Publications Verification
Cat. No.: HY-112980
CAS No.: 1258984-36-9
Purity:  97.79%
Target:  

DNA/RNA Synthesis

Research Areas:  

Neurological Disease

Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
loading...
    loading...
7
7 Publications Verification
Cat. No.: HY-112980A
Purity:  98.91%
Target:  

DNA/RNA Synthesis

Research Areas:  

Neurological Disease

Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .
loading...
    loading...
4
4 Cited Publications
Cat. No.: HY-B0956
CAS No.: 1263-89-4
Synonyms: Aminosidine sulfate
Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections .
loading...
    loading...
2
2 Cited Publications
Cat. No.: HY-D0150
CAS No.: 107091-89-4
Thiazole Orange is an asymmetric anthocyanin dye that can be coupled with oligonucleotides (ONs) to prepare fluorescent hybridization probes. Thiazole Orange has been widely used in biomolecular detection and staining of DNA/ RNA in gels and can be used for reticulocyte analysis. Thiazole orange generates a significant fluorescence enhancement and high quantum yield when it binds with nucleic acids, especially RNA. Thiazole orange can permeate living cell membranes. Thiazole orange can use UV light for detection, but can also be detected with blue light. The excitation and emission of Thiazole orange are λex = 510 nm (488 nm and 470 nm also show strong excitation) and λem = 527 nm, respectively .
loading...
    loading...
1
1 Cited Publications
Cat. No.: HY-D2171A
AF488 DBCO ditriethylamineis a fluorescent dye and also a click chemistry reagent that can label azide-containing biomolecules. AF488 DBCO ditriethylaminemediates the coupling reaction with azide-modified 2'-OMe RNA oligonucleotides. DBCO is a bioorthogonal partner of azides and enables covalent coupling without copper (Ex/Em = 470/520 nm) .
loading...
    loading...
1
1 Cited Publications
Cat. No.: HY-W039442
CAS No.: 64183-27-3
Research Areas:  

Infection Cancer

2′-Deoxy-2′-fluoroadenosine is a fluorinated deoxyadenosine with antitumor and antiviral activity, able to interfere with viral or cancer cell replication by being incorporated into DNA. 2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP .
loading...
    loading...
1
1 Cited Publications
Cat. No.: HY-113138
CAS No.: 2140-69-4
Purity:  99.05%
Synonyms: N3-Methyluridine
3-Methyluridine (m 3U; N3-Methyluridine) is a methylated nucleotide present in ribosomal RNA (rRNA), mainly targeting specific base sites of RNA molecules such as 23S rRNA. 3-Methyluridine can introduce a methyl group at the N3 position of uracil, affecting the secondary structure stability and base pairing ability of RNA, and regulating ribosome function. For example, it affects ribosomal subunit binding and tRNA interaction. 3-Methyluridine is often used as a key raw material for the synthesis of modified nucleotides, and is used to construct RNA oligonucleotides containing methylation modifications to study the effects of RNA methylation on gene expression and drug resistance .
loading...
    loading...
Cat. No.: HY-148505
CAS No.: 1197033-17-2
Purity:  98.92%
5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite blongs to modified antisense oligonucleotide. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite allows the formation of a specific conformation of the furanose ring of the oligonucleotide through the introduction of a cEt modification, enhancing the ability to hybridize to complementary RNA. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is mainly used in the research of regulation of gene expression related to metabolic diseases, cardiovascular diseases, cancers and the development of antisense compounds .
loading...
    loading...
Cat. No.: HY-148503
CAS No.: 1197033-19-4
Purity:  98.55%
Research Areas:  

Others

5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is a nucleoside phosphoramidite monomer used to synthesize locked nucleic acid (LNA) analog oligonucleotides. It can be used as a building block of antisense oligonucleotides (ASOs) to target complementary RNA sequences. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) locks the furanose ring into an N-type conformation through 2',4'-constrained ethyl (cEt) modification, enhancing hybridization affinity and mismatch discrimination with RNA, while significantly improving the resistance of oligonucleotides to exonuclease digestion. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) mediates RNase H-dependent mRNA degradation or inhibits translation by forming a stable hybrid with RNA, thereby achieving gene expression regulation. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is mainly used in the development of antisense drugs, gene function research and oligonucleotide synthesis related to disease treatment .
loading...
    loading...
Cat. No.: HY-147217
CAS No.: 1403787-62-1
Purity:  97.10%
Synonyms: ISIS 505358
Target:  

HBV

Research Areas:  

Infection

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
loading...
    loading...
Cat. No.: HY-21997
CAS No.: 136834-22-5
DMT-2'fluoro-da(bz) amidite is a key intermediate for synthesizing antisense oligonucleotides with high nuclease resistance, high RNA binding affinity, and maintained base-pair specificity .
loading...
    loading...
Cat. No.: HY-132608
CAS No.: 1432726-13-0
Purity:  96.44%
Synonyms: ISIS-420915 sodium
Target:  

Transthyretin (TTR)

Research Areas:  

Neurological Disease

Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
loading...
    loading...
Cat. No.: HY-147217A
CAS No.: 2563929-84-8
Purity:  98.44%
Synonyms: ISIS 505358 sodium
Target:  

HBV

Research Areas:  

Infection

Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
loading...
    loading...
Cat. No.: HY-138577
CAS No.: 161442-19-9
Purity:  99.88%
2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
loading...
    loading...
Cat. No.: HY-145724
CAS No.: 1251830-50-8
Purity:  96.05%
Synonyms: Kyndrisa; GSK2402968A; PRO051
Research Areas:  

Neurological Disease

Drisapersen (Kyndrisa) is a 2 '-O-methyl phosphorothioate RNA antisense oligonucleotide that induces exon 51 skipping. Drisapersen induces skipping of exon 51 during Dystrophin pre-mRNA splicing, allowing the synthesis of partially functional Dystrophin. Drisapersen can be used in research related to Duchenne muscular dystrophy .
loading...
    loading...
Cat. No.: HY-12854
CAS No.: 868169-64-6
Purity:  99.43%
Synonyms: GRN163L
Target:  

Telomerase Apoptosis

Research Areas:  

Cardiovascular Disease Cancer

Imetelstat (GRN163L) is a 13-mer oligonucleotide and competitive Telomerase inhibitor. Imetelstat binds with high affinity to the template region of the RNA component of human telomerase. Imetelstat induces Apoptosis. Imetelstat is capable of selectively eliminating myelofibrosis hematopoietic stem cells. Imetelstat leads to the loss of a cancer cell's ability to maintain telomere length, resulting in the inhibition of cell proliferation .
loading...
    loading...
Cat. No.: HY-W048488
CAS No.: 163759-49-7
Research Areas:  

Others

2'-O-MOE-5-Me-rU is a dual chemically modified ribonucleoside, which is a key modifying unit in the development of RNA drug preparations (such as antisense oligonucleotides ASO, siRNA). Its core function is to significantly enhance the stability, target affinity and drugability of nucleic acid drugs.
loading...
    loading...
2′-O-Methyl-8-methyl guanosine
0 Images
Guanosine, 8-methyl-2′-O-methyl-
Cat. No.: HY-145998
CAS No.: 2306782-64-7
Purity:  98.61%
Synonyms: m8Gm
2′-O-Methyl-8-methyl guanosine (m8Gm) is a Z-form RNA stabilizer. 2′-O-Methyl-8-methyl guanosine can markedly stabilize the Z-RNA at low salt conditions . m8Gm-contained oligonucleotides stabilize the Z-DNA under low salt conditions .
loading...
    loading...
ISIS 626112 sodium
0 Images
ION-626112 (sodium)
Cat. No.: HY-159693A
Synonyms: ION-626112 sodium
ISIS 626112 sodium (ION-626112 sodium) is a blood-brain barrier-permeable MOE-gapmer antisense oligonucleotide and also an inhibitor of the Malat1 long non-coding RNA. ISIS 626112 sodium triggers RNase H1-mediated cleavage and degradation of complementary Malat1 RNA. ISIS 626112 sodium dose-dependently reduces Malat1 RNA levels in all tested central nervous system regions and major central nervous system cell types in mice, with glial cells showing higher sensitivity than neurons .
loading...
    loading...
Cat. No.: HY-160230
Research Areas:  

Infection

ssRNA41 sodium is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. It derives from ssRNA40 by replacement of all U nucleotides with adenosine. ssRNA41 sodium is unable to induce the production of type IFNs, and therefore can be used as a negative control for ssRNA40 .
loading...
    loading...