2. Search Result
Search Result
Results for "

binding-site

" in MedChemExpress (MCE) Product Catalog:

516

Inhibitors & Agonists

8

Screening Libraries

11

Fluorescent Dyes

10

Biochemical Assay Reagents

46

Peptides

1

MCE Kits

15

Inhibitory Antibodies

34

Natural
Products

30

Isotope-Labeled Compounds

2

Antibodies

5

Click Chemistry

7

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-100714A
    D-AP5
    25+ Cited Publications

    D-APV; D-2-Amino-5-phosphonovaleric acid

    		 iGluR Neurological Disease
    D-AP5 (D-APV) is a selective and competitive NMDA receptor antagonist with a Kd of 1.4 μM. D-AP5 (D-APV) inhibits the glutamate binding site of NMDA receptors .
    D-AP5
  • HY-P9963
    Blinatumomab
    2 Publications Verification

    bscCD19xCD3; AMG-103; MEDI-538; MT-103; BLINCYTO

    		 CD19 Cancer
    Blinatumomab (Anatumomab) is a bispecific monoclonal antibody with two binding sites, one for CD3E on T cells and one for CD19 on B cells. Blinatumomab can be used in research for acute lymphoblastic leukemia .
    Blinatumomab
  • HY-D0987
    Stains-All

    		Calmodulin Others
    Stains-All, a cationic carbocyanine dye, is a convenient probe to study the structural features of the individual calcium-binding sites of calmodulin (CaM) and related calcium-binding proteins (CaBP) .
    Stains-All
  • HY-P99009
    Batoclimab

    RVT-1401; HBM9161; IMVT-1401

    		 Fc Receptor (FcR) Inflammation/Immunology
    Batoclimab (RVT-1401) is a fully humanized IgG1 monoclonal antibody targeting FcRn. Batoclimab has high affinity for the IgG-binding site on FcRn. By competitively binding to the IgG binding site on FcRn, Batoclimab blocks FcRn-mediated recycling of IgG, resulting in enhanced degradation and subsequent reductions in IgG levels. Batoclimab can be used in the research of autoimmune diseases such as myasthenia gravis and thyroid eye disease .
    Batoclimab
  • HY-100815B
    (RS)-AMPA

    (±)-AMPA

    		 iGluR Neurological Disease
    (RS)-AMPA ((±)-AMPA) is a glutamate analogue and a potent and selective excitatory neurotransmitter L-glutamic acid agonist. (RS)-AMPA does not interfere with binding sites for kainic acid or NMDA receptors .
    (RS)-AMPA
  • HY-P1315
    Papain inhibitor

    Glycylglycyl-L-tyrosyl-L-arginine

    		 Cathepsin Others
    Papain inhibitor (Glycylglycyl-L-tyrosyl-L-arginine) is a competitive papain-targeting enzyme inhibitor with a Ki of 9 μM. Papain inhibitor binds directly to the substrate binding site of papain, inhibiting substrate hydrolysis by the enzyme. Papain inhibitor functions as a component of an electrochemical probe for the detection of papain .
    Papain inhibitor
  • HY-122422
    Gepirone

    		5-HT Receptor Others
    Gepirone is a selective and affinitive 5-HT1A agonist. Gepirone binds selectively to 5-HT1A receptor binding site. Gepirone acts as an antidepressant agent can be used for anxiety and major depressive disorder research .
    Gepirone
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-16307
    MB05032
    5+ Cited Publications

    		 FBPase Metabolic Disease
    MB05032 is a special and efficacious gluconeogenesis inhibitor targeted the AMP binding site of fructose 1,6-bisphosphatase (FBPase) with an IC50 value of 16 nM.
    MB05032
  • HY-119323
    7-Azido-4-methylcoumarin
    1 Publications Verification

    		 Fluorescent Dye Others
    7-Azido-4-methylcoumarin is a selective coumarin-based fluorescent probe for hydrogen sulfide (H2S). In the presence of H2S, the aromatic azido group of 7-Azido-4-methylcoumarin is selectively reduced to produce the fluorescently active 7-amino-4-methylcoumarin (AMC). 7-Azido-4-methylcoumarin binds to the coumarin/phenol-binding site of BSA, the aglycone-binding site of UGT1A6, and the substrate-binding site of SULT1A1, respectively. 7-Azido-4-methylcoumarin retains its fluorescent properties after covalent binding, acts as a fluorescent H2S probe, and does not react with cysteine, homocysteine or glutathione (Ex/Em = 340/445 nm) .
    7-Azido-4-methylcoumarin
  • HY-W003969
    Aminopicoline

    Ascensil; 2-Amino-4-methylpyridine

    		 NO Synthase Inflammation/Immunology
    Aminopicoline (Ascensil) is a potent and non-selective inhibitor of nitric oxide synthase (NOS) isoenzymes (iNOS, nNOS, eNOS). Aminopicoline competes with arginine at the substrate-binding site of nitric oxide synthase, reduces cellular nitric oxide production, inhibits the elevation of plasma nitrate, increases mean arterial pressure at high doses, and also serves as a basis for radiolabeled ligands to localize nitric oxide synthase binding sites. Aminopicoline can be used in the research of diseases associated with septic shock, joint inflammation, intestinal inflammation, and CNS inflammation .
    Aminopicoline
  • HY-D1605
    BODIPY FL L-Cystine
    1 Publications Verification

    		 Fluorescent Dye Others
    BODIPY FL L-Cystine is a thiol-reactive, green-fluorescent dye. BODIPY FL L-Cystine can be the labeling of membrane proteins, proteins with hydrophobic binding sites, or hydrophobic ligands. (λex=504 nm, λem=511 nm) .
    BODIPY FL L-Cystine
  • HY-P0185
    Endomorphin 1
    3 Publications Verification

    		 Opioid Receptor Neurological Disease
    Endomorphin 1, a high affinity, highly selective agonist of the μ-opioid receptor (Ki: 1.11 nM), displays reasonable affinities for kappa3 binding sites, with Ki value between 20 and 30 nM. Endomorphin 1 has antinociceptive properties .
    Endomorphin 1
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-B0115
    Pizotifen
    2 Publications Verification

    Pizotyline; BC-105

    		 5-HT Receptor Neurological Disease
    Pizotifen (Pizotyline) is a potent 5-HT2 receptor antagonist, with a high affinity for 5-HT1C binding site.
    Pizotifen
  • HY-D1030
    Fluorescein Biotin

    		Fluorescent Dye Others
    Fluorescein Biotin is a fluorescent modulator with avidin and streptavidin binding activity. Fluorescein Biotin binds to the biotin-binding sites of avidin and streptavidin, and this binding induces significant fluorescence quenching .
    Fluorescein Biotin
  • HY-B0429
    Pancuronium dibromide

    		nAChR Neurological Disease
    Pancuronium dibromide, a bis-quaternary steroid, is a neuromuscular relaxant. Pancuronium dibromide inhibits neuromuscular transmission by competing with acetylcholine for binding sites on nACh receptors. Pancuronium dibromide also inhibits cardiac muscarinic receptors and has a sympathomimetic action .
    Pancuronium dibromide
  • HY-D1078
    5(6)-Carboxy-2',7'-dichlorofluorescein diacetate

    		Fluorescent Dye Reactive Oxygen Species (ROS) P-glycoprotein Others
    5 (6)-Carboxy-2',7'-dichlorofluorescein diacetate is a fluorescein-based reactive oxygen species (ROS) probe and also a MRP2 substrate. 5 (6)-Carboxy-2',7'-dichlorofluorescein diacetate serves as a substrate for intracellular esterases, which cleave its acetate groups to generate a fluorescent product capable of detecting intracellular ROS. 5 (6)-Carboxy-2',7'-dichlorofluorescein diacetate is ATP-dependent and is transported via a single MRP2 binding site; it competes with LTC4 for MRP2 binding sites and inhibits MRP2-mediated LTC4 transport (Ex/Em = 496/525 nm) .
    5(6)-Carboxy-2',7'-dichlorofluorescein diacetate
  • HY-B0115A
    Pizotifen malate
    2 Publications Verification

    Pizotyline malate; BC-105 malate

    		 5-HT Receptor Neurological Disease
    Pizotifen malate (Pizotyline malate) is a potent 5-HT2 receptor antagonist, with a high affinity for 5-HT1C binding site.
    Pizotifen malate
  • HY-P1741
    Fibrinogen-Binding Peptide
    1 Publications Verification

    		 Thrombin Cardiovascular Disease
    Fibrinogen-Binding Peptide (designed by anticomplementarity hypothesis) is a presumptive peptide mimic of the vitronectin binding site on the fibrinogen receptor. Fibrinogen-Binding Peptide binds fibrinogen and inhibits both the adhesion of platelets to fibrinogen and platelet aggregation, and also inhibits the adhesion of platelets to vitronectin .
    Fibrinogen-Binding Peptide
  • HY-N7433
    4,6-O-Ethylidene-α-D-glucose

    Ethylidene-glucose

    		 GLUT Endogenous Metabolite Metabolic Disease
    4,6-O-ethylidene-α-D-glucose (Ethylidene-glucose), a glucose derivative, is a competitive exofacial binding-site inhibitor on glucose transporter 1 (GLUT1) with a Ki of 12 mM for wild-type 2-deoxy-D-glucose transport .
    4,6-O-Ethylidene-α-D-glucose
  • HY-100982
    (E) -4-Hydroxycrotonic acid

    trans-4-Hydroxycrotonic acid; trans-γ-Hydroxycrotonic acid; T‐HCA

    		 GABA Receptor Neurological Disease
    (E)-4-Hydroxycrotonic acid (T-HCA) is a high-affinity ligand for GHB binding sites, with a ki value of 1.1 μM. The introduction of diaryl substituents into (E)-4-Hydroxycrotonic acid significantly enhances its affinity for GHB binding sites, with ki values ranging from 0.023 to 0.075 μM. (E)-4-Hydroxycrotonic acid holds promise for optimizing GHB ligand structures and assisting in the development of effective three-dimensional pharmacophore models .
    (E) -4-Hydroxycrotonic acid
  • HY-D0871
    CHES

    N-Cyclohexyltaurine

    		 Biochemical Assay Reagents Influenza Virus Infection
    CHES (N-Cyclohexyltaurine) is a biological buffer reagent that binds to influenza virus hemagglutinin (HA). CHES mimics the binding mode of sialic acid to the HA receptor-binding site .
    CHES
  • HY-124673
    AF40431
    1 Publications Verification

    		 Neurotensin Receptor Neurological Disease
    AF40431, the first reported small-molecule ligand of sortilin, has an IC50 of 4.4 µM and a Kd of 0.7 µM . AF40431 is bound in the neurotensin-binding site of sortilin .
    AF40431
  • HY-P0186A
    Endomorphin 2 TFA

    		Opioid Receptor Neurological Disease
    Endomorphin 2 TFA, a high affinity, highly selective agonist of the μ-opioid receptor, displays reasonable affinities for kappa3 binding sites, with Ki value between 20 and 30 nM .
    Endomorphin 2 TFA
  • HY-163097
    ZCAN262

    		iGluR Neurological Disease
    ZCAN262 (compound 6 ) is an AMPA modulator. ZCAN262 prevents AMPA-mediated excitotoxicity by targeting an allosteric binding site .
    ZCAN262
  • HY-148547
    q-FTAA

    		Amyloid-β Neurological Disease
    q-FTAA is an oligothiophene. q-FTAA competes for binding to the X-34 binding site on Aβ fibrils. q-FTAA is applicable to research related to Alzheimer's disease .
    q-FTAA
  • HY-B0149S1
    Tranexamic acid-d2-1

    		Isotope-Labeled Compounds Cancer
    Tranexamic acid-d2-1 is the deuterium labeled Tranexamic acid . Tranexamic acid (Transamin) is an antifibrinolytic for blocking lysine-binding sites of plasmin and elastase-derived plasminogen fragments with IC50 of 5 mM .
    Tranexamic acid-d2-1
  • HY-W009234
    6-Chloroguanineriboside

    6-Chloroguanosine

    		 Nucleoside Antimetabolite/Analog Others
    6-Chloroguanineriboside (6-Chloroguanosine) is a purine nucleoside analog. 6-Chloroguanineriboside has extremely low affinity for guanosine binding sites in rat brain (Ki: 253.1 μM) .
    6-Chloroguanineriboside
  • HY-137974
    8-Epixanthatin
    1 Publications Verification

    		 STAT Apoptosis Cancer
    8-Epixanthatin is a potential colchicine binding site inhibitor isolated from Xanthium chinese Mill. 8-Epixanthatin can inhibit the activation of STAT3, induce apoptosis, and has anti-tumor activity .
    8-Epixanthatin
  • HY-153178
    HECT E3-IN-1

    		E1/E2/E3 Enzyme Others
    HECT E3-IN-1 (compound 3) is a HECT E3 ligase inhibitor. HECT E3-IN-1 (compound 3) disrupts Ub binding to the noncovalent Ub-binding site of Nedd4-1 .
    HECT E3-IN-1
  • HY-P0294A
    Hexa-His TFA

    6X His Tag TFA

    		 Biochemical Assay Reagents Others
    Hexa-His TFA is a peptide consisting of 6 His residues, used as a metal binding site for the recombinant protein .
    Hexa-His TFA
  • HY-136280
    Panamesine

    EMD 57445

    		 Sigma Receptor Neurological Disease
    Panamesine (EMD 57445) is a sigma receptor ligand, which has a high affinity (IC50 6 nM) and selectivity for sigma binding sites. Panamesine is a potential atypical neuroleptic agent .
    Panamesine
  • HY-155941
    5-Hydroxydecanoic acid

    		Potassium Channel Neurological Disease
    5-Hydroxydecanoic acid (5-HD） is a KATP channel antagonist，which has the effect of blocking the K KATP channel only during ischaemia by competing with the ATP binding site and does not affect pancreatic KATP channels .
    5-Hydroxydecanoic acid
  • HY-121524
    DJ101

    		Microtubule/Tubulin Cancer
    DJ101 is a potent and metabolically stable tubulin inhibitor. DJ101 targets the colchicine binding site and overcomes taxane resistance. DJ101 also inhibits melanoma tumor growth and lung metastasis. DJ101 can be used for prostate cancer research .
    DJ101
  • HY-150761
    MY-875
    1 Publications Verification

    		 Microtubule/Tubulin Apoptosis Cancer
    MY-875 is a competitive microtubulin polymerization inhibitor with an IC50 value of 0.92 μM. MY-875 inhibits microtubulin polymerization by targeting colchicine binding sites and activates the Hippo pathway. MY-875 induces apoptosis and has anticancer activity .
    MY-875
  • HY-P1507
    Fibrinogen Binding Inhibitor Peptide

    		Integrin Cardiovascular Disease
    Fibrinogen Binding Inhibitor Peptide is a dodecapeptide (HHLGGAKQAGDV, H12), which is a fibrinogen γ-chain carboxy-terminal sequence (γ400-411). Fibrinogen Binding Inhibitor Peptide is a specific binding site of the ligand for activated glycoprotein (GP) IIb/IIIa.
    Fibrinogen Binding Inhibitor Peptide
  • HY-N7437
    Akuammidine

    		Opioid Receptor DNA/RNA Synthesis Neurological Disease Inflammation/Immunology
    Akuammidine, isolated from the seeds of Picralima nitida, shows a preference for μ-opioid binding sites with Ki values of 0.6, 2.4 and 8.6 μM at μ-, σ- and κ-opioid binding sites, respectively. Akuammidine possesses anti-inflammatory and anti-asthmatic properties .
    Akuammidine
  • HY-10830A
    PBPE hydrochloride

    		Estrogen Receptor/ERR Cancer
    PBPE hydrochloride is a derivative of tamoxifen (HY-13757A) and a selective ligand for the anti-estrogen binding site (AEBS), the binding affinities (Ki) of PBPE hydrochloride and MBPE to AEBS are 8.79 and 17.57 nM, respectively .
    PBPE hydrochloride
  • HY-157712
    08:0 PI(4,5)P2 ammonium

    		Biochemical Assay Reagents Others
    08:0 PI(4,5)P2 ammonium is suitable for identifying its binding site at the transient receptor potential vanilloid 4 (TRPV 4 N) terminus .
    08:0 PI(4,5)P2 ammonium
  • HY-P3892
    Protein Kinase C (19-35) Peptide

    		PKC Inflammation/Immunology
    Protein Kinase C (19-35) Peptide is the PKC pseudosubstrate inhibitor/region. Protein Kinase C (19-35) Peptide possibly blocks the substrate-binding site in its kinase domain, makes the cytoplasmic form of PKC inactive .
    Protein Kinase C (19-35) Peptide
  • HY-P4788
    Acetyl-Amyloid β-Protein (1-6) amide

    		Amyloid-β Neurological Disease
    Acetyl-Amyloid β-Protein (1-6) amide is a hexapeptide that contains a potential copper(II) binding site. Acetyl-Amyloid β-Protein (1-6) amide can be used for research of Alzheimer's disease and related disorders .
    Acetyl-Amyloid β-Protein (1-6) amide
  • HY-D1608
    BODIPY FL Thapsigargin

    		Calcium Channel Others
    BODIPY FL Thapsigargin is a potent green fluorescent dye. BODIPY FL Thapsigargin inhibits intracellular SERCA-type Ca2+ pumps present in the sarcoplasmic/endoplasmic reticulum. BODIPY FL Thapsigargin used for investigation of thapsigargin binding sites in live cells .
    BODIPY FL Thapsigargin
  • HY-P1741A
    Fibrinogen-Binding Peptide TFA
    1 Publications Verification

    		 Integrin Cardiovascular Disease
    Fibrinogen-Binding Peptide TFA (designed by anticomplementarity hypothesis) is a presumptive peptide mimic of the vitronectin binding site on the fibrinogen receptor. Fibrinogen-Binding Peptide TFA binds fibrinogen and inhibits both the adhesion of platelets to fibrinogen and platelet aggregation, and also inhibits the adhesion of platelets to vitronectin .
    Fibrinogen-Binding Peptide TFA
  • HY-161800
    Aminoacyl tRNA synthetase-IN-3

    		Aminoacyl-tRNA Synthetase Infection
    Aminoacyl tRNA synthetase-IN-3 (compound 36K3) is an inhibitor of lysine tRNA synthetase (PfLysRS) from Plasmodium falciparum (IC50=59.2 nM), which inhibits the activity of PfLysRS by occupying the ATP binding site and L-lysine binding site of PfLysRS. Aminoacyl tRNA synthetase-IN-3 can be used in the development of antimalarial drugs .
    Aminoacyl tRNA synthetase-IN-3
  • HY-P0186
    Endomorphin 2

    		Opioid Receptor Neurological Disease
    Endomorphin 2, a high affinity, highly selective agonist of the μ-opioid receptor, displays reasonable affinities for kappa3 binding sites, with Ki value between 20 and 30 nM.
    Endomorphin 2
  • HY-152156
    Tubulin inhibitor 11

    		Microtubule/Tubulin Apoptosis Cancer
    Tubulin inhibitor 11 is a potent and orally active tubulin inhibitor. Tubulin inhibitor 11 targets the Colchicine binding site on tubulin, inhibits tubulin polymerization, promotes mitotic blockade and apoptosis .
    Tubulin inhibitor 11
  • HY-100815C
    (RS)-AMPA hydrobromide

    (±)-AMPA hydrobromide

    		 iGluR Neurological Disease
    (RS)-AMPA ((±)-AMPA) hydrobromide is a glutamate analogue and a potent and selective excitatory neurotransmitter L-glutamic acid agonist. (RS)-AMPA hydrobromide does not interfere with binding sites for kainic acid or NMDA receptors .
    (RS)-AMPA hydrobromide
  • HY-P11421
    Cys-His Tag

    		Biochemical Assay Reagents Others
    Cys-His Tag is a dual-purpose protein tag combining a cysteine residue and a Histidine tag. Cys-His Tag can be used to improve marker specificity or introduce covalent binding sites .
    Cys-His Tag
  • HY-106825
    Clanfenur

    		Microtubule/Tubulin Cancer
    Clanfenur is a substituted benzoylphenylurea, an analogue of the pesticide fenfluramide, with potential antineoplastic activity. Clanfenur can bind to the colchicine-binding site on β-tubulin, inhibit microtubule polymerization, and thus prevent tumor cell replication .
    Clanfenur

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: