HBV
Hepatitis B virus
All Product Categories
-
HBV Related Products (384)
Related Products (384)
-
Antibodies (2)
-
Taurolithocholic acid
0 ImagesTaurolithocholic acid is an orally active bile acid and antiviral agent. Taurolithocholic acid upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis (Ferroptosis), viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic acid also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Selgantolimod
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Merimepodib
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Bifendate
0 ImagesSynonyms: DDBBifendate (DDB), extracted from Schisandrae chinensis, is an orally active anti-HBV agent against chronic hepatitis B. Bifendate inhibits ATG5-dependent autophagy and attenuates oleic acid-induced lipid accumulation with anti-oxidant properties in vitro. Bifendate can decrease alanine transaminase (ALT) level in mice. Bifendate attenuates hepatic steatosis in cholesterol/bile salt- and high-fat diet-induced hypercholesterolemia in mice. Bifendate potently increases the activity of cytochrome proteins (CYPs) and reverse P-gp-mediated multi-drug resistance (MDR). -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Punicalin
0 ImagesPunicalin is a species that can be isolated from the leaves of Punica granatum. Punicalin is an active molecule against hepatitis b virus (HBV). Punicalin can induce pyroptosis. Punicalin is a Carbonic anhydrase inhibitor. Punicalin blocks the binding of S-glycoprotein and ACE2 receptors. Pnuicalin has anti-inflammatory, antioxidant and antiviral activity. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Bepirovirsen sodium
0 ImagesCat. No.: HY-147217ACAS No.: 2563929-84-8Synonyms: ISIS 505358 sodiumBepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC). -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Osalmid
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Entecavir monohydrate
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Bicyclol
0 ImagesSynonyms: SY801Bicyclol (SY801) is an orally active derivative of the traditional Chinese medicine Schisandra chinensis, which has antiviral, anti-inflammatory, immunomodulatory, antioxidant, anti-steatosis, anti-fibrotic and anti-tumor activities. Bicyclol regulates the expression of heat shock proteins and plays an anti-apoptosis role in hepatocytes. Bicyclol reduces the activation of NF-κB and the levels of inflammatory factors in hepatocytes infected with hepatitis C virus (HCV) by inhibiting the activation of the ROS-MAPK-NF-κB pathway, and prevents ferroptosis in acute liver injury. Bicyclol can change the expression of Mdr-1, GSH/GST and Bcl-2, increase the intracellular concentration of anticancer drugs, and sensitize drug-resistant cells to anticancer drugs. Bicyclol inhibits the proliferation of human malignant hepatoma cells by regulating the PI3K/AKT pathway and the Ras/Raf/MEK/ERK pathway. Bicyclol can be used in the study of chronic hepatitis, acute liver injury, nonalcoholic fatty liver disease, liver fibrosis and hepatocellular carcinoma. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Telbivudine
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Isoscopoletin
0 ImagesIsoscopoletin (6-Hydroxy-7-methoxycoumarin) is an active constituent in Artemisia argyi leaves. Isoscopoletin shows substantial inhibition against cell proliferation, with IC50s of 4.0 μM and 1.6 μM for human CCRF-CEM leukaemia cells and multidrug resistant subline CEM/ADR5000, respectively. Isoscopoletin (6-Hydroxy-7-methoxycoumarin) possesses inhibitory activity against HBV replication. Isoscopoletin exhibits anti-inflammatory activity through inhibition of MAPK/NF-κB/STAT/AKT signaling pathway. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Squalamine
0 ImagesSynonyms: MSI-1256; ENT-01 free acidSqualamine (MSI-1256) is an aminosterol compound with broad-spectrum antiviral activity. Squalamine makes cells less conducive to certain viral replication by altering the electrostatic interactions in the inner membrane of host cells. Squalamine also has antibacterial and antitumor activities. Squalamine has broad-spectrum antibacterial activity against Gram-negative and Gram-positive bacteria, fungi and protozoa. Squalamine inhibits tumor-related angiogenesis and the growth of human breast cancer cells. Squalamine restores the function of enteric nervous system in Parkinson,s disease mouse models. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Azvudine
0 ImagesSynonyms: RO-0622; FNCAzvudine (RO-0622) is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine exerts highly potent inhibition on HIV-1 (EC50s ranging from 0.03 to 6.92 nM) and HIV-2 (EC50s ranging from 0.018 to 0.025 nM). Azvudine inhibits NRTI-resistant viral strains. Azvudine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Morphothiadin
0 ImagesSynonyms: GLS4 -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Adefovir
0 ImagesSynonyms: GS-0393; PMEAAdefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- ccc_R08
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Tobevibart
0 ImagesSynonyms: VIR-3434Tobevibart (VIR-3434) is a human IgG1 lambda monoclonal antibody against hepatitis B virus (HBV) surface antigen (HBsAg). Tobevibart shows potent neutralization against HBsAg from all HBV genotypes in vitro and inhibits viral entry of HBV and hepatitis delta virus (HDV). Recommend Isotype Controls: Human IgG1 lambda2, Isotype Control (HY-P990096). -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
4-Hydroxyacetophenone
0 Images4-Hydroxyacetophenone (P-hydroxyacetophenone) is a major hepatoprotective and choleretic compound found in Artemisia and Illicium plants, exhibiting antiviral and anti-inflammatory effects against hepatitis B virus. Additionally, 4-Hydroxyacetophenone inhibits cancer cell adhesion, invasion, and migration by remodeling actin. 4-Hydroxyacetophenone holds promise for research in the fields of inflammatory diseases and cancer. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Bepirovirsen
0 ImagesCat. No.: HY-147217CAS No.: 1403787-62-1Synonyms: ISIS 505358Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC). -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Oxethazaine
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
No matching results
No matching results
No matching results
No matching results
No matching results
No matching results
No matching results
No matching results
No matching results
No matching results