HBV

Hepatitis B virus

HBV

Related Products

HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.

HBV Related Products (371)
Antibodies (2)

By Effects:	Inhibitors (335)

Cat. No.	Product Name	Effect	Purity	Chemical Structure

HY-147217

Bepirovirsen	Inhibitor	98.44%
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

HY-B0955

Oxethazaine	Inhibitor	99.94%
Oxethazaine (Oxetacaine), a precursor of phentermine?acidic, is an acid-resistent and orally active analgesic agent. Oxethazaine (Oxetacaine) has the potential for the relief of pain associated with?peptic ulcer disease?or?esophagitis.

HY-17426

Famciclovir	Inhibitor	99.69%
Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection.

HY-N6939

Pseudolaric Acid B	Inhibitor	99.47%
Pseudolaric Acid B is an orally active diterpene acid. Pseudolaric Acid B has anti-fungal, anti-fertility, anti-angiogenesis and anticancer activity, and can induce tumor cell apoptosis and autophagy. In addition, Pseudolaric Acid B can inhibit the secretion of hepatitis B virus (HBV) and has immunosuppressive effect, selectively inhibiting the proliferation of T lymphocytes and the production of IL-2.

HY-N2189

Swertisin	Inhibitor	99.54%
Swertisin is an oral adenosine A1 receptor antagonist and an SGLT2 inhibitor. Swertisin has anti-diabetic, antioxidant properties, inhibits HBV, and improves cognitive and memory impairments in mice.

HY-19314A

Azvudine hydrochloride	Inhibitor	99.19%
Azvudine (RO-0622) hydrochloride is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine hydrochloride exerts highly potent inhibition on HIV-1 (EC₅₀s ranging from 0.03 to 6.92 nM) and HIV-2 (EC₅₀s ranging from 0.018 to 0.025 nM). Azvudine hydrochloride inhibits NRTI-resistant viral strains. Azvudine (hydrochloride) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

HY-147266

Elebsiran sodium	Inhibitor
Elebsiran (VIR-2218) sodium is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran sodium leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran sodium binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran sodium can be used for the study of chronic HBV/HDV infections.

HY-W060316

β-Thujaplicinol	Inhibitor	99.87%
β-Thujaplicinol (3-Hydroxy-5-isopropyltropolone) is an inhibitor of hepatitis B virus (HBV) ribonuclease H. β-Thujaplicinol inhibits RNAseHs of HBV genotypes D and H with IC₅₀ values of 5.9 and 2.3 μM, respectively.

HY-109168

Bersacapavir	Inhibitor	98.90%
Bersacapavir (JNJ-6379) is an HBV capsid assembly modulator. Bersacapavir exerts a dual mechanism of action against both early and late stages of HBV infection by forming complete genome-free empty capsids and inhibiting de novo synthesis of cccDNA. Bersacapavir inhibits HBV replication. Bersacapavir can be used in the research of hepatitis B.

HY-100029

Bay 41-4109	Inhibitor	99.24%
BAY 41-4109 is a potent inhibitor of human hepatitis B virus (HBV) with an IC₅₀ of 53 nM.

HY-138407

Evixapodlin	Inhibitor	98.14%
Evixapodlin (GS-4224) is a human PD-1/PD-L1 protein/protein interaction inhibitor with an IC₅₀ of 0.213 nM. Evixapodlin has anticancer and antiviral functions.

HY-13782A

Tenofovir Disoproxil	Inhibitor	99.52%
Tenofovir Disoproxil (Bis(POC)-PMPA) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B.

HY-109197

Vonafexor	Inhibitor	99.38%
Vonafexor (EYP001) is an orally active, non-steroidal and selective FXR agonist. Vonafexor shows significant HBsAg reduction when combined with Peg-IFNα. Vonafexor can be used for anti-HBV research.

HY-124600

NVR 3-778	Inhibitor	99.88%
NVR 3-778 is a first-in-Class and oral bioavailable HBV CAM (capsid assembly modulator) belonging to the SBA (sulfamoylbenzamide) class, with anti-HBV activity.

HY-10545A

Taribavirin hydrochloride	Inhibitor	99.96%
Taribavirin hydrochloride is an orally active inosine monophosphate dehydrogenase inhibitor, has activity against a wide range of viruses, especially the hepatitis C virus and influenza virus. Taribavirin hydrochloride is a Ribavirin proagent, is designed to concentrate within the liver to target HCV-infected hepatocytes while minimizing distribution within red blood cells (RBCs) and the development of hemolytic anemia.

HY-169993

ALG-000184	Inhibitor	99.69%
ALG-000184 is an orally effective inhibitor of hepatitis B virus (HBV), and it is also a prodrug of ALG-001075 (HY-177022). ALG-000184 can inhibit the production of HBV DNA in liver cells. ALG-000184 can be used in the research of chronic hepatitis B.

HY-124614

GLP-26	Inhibitor	98.36%
GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC₅₀=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools. GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-N0699

Daphnoretin	Inhibitor	99.83%
Daphnoretin (Dephnoretin; Thymelol) is a protein kinase C (PKC) activator that inhibits the expression of hepatitis B virus (HBV) surface antigen (HBsAg) and exhibits antiviral activity. Daphnoretin exerts its antitumor effects by inhibiting the activation of the PI3K/AKT signaling pathway and triggers the mitochondrial apoptosis pathway. Daphnoretin alleviates chondrocyte apoptosis and inflammatory responses by inhibiting endoplasmic reticulum stress and activation of the NLRP3 inflammasome. Daphnoretin regulates the differentiation and maturation of dendritic cells, inhibits their immunostimulatory function by downregulating the phosphorylation level of JNK, and thus exerts a protective effect in skin graft rejection.

HY-13859

Clevudine	Inhibitor	99.84%
Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice.

HY-109035

Inarigivir soproxil	Inhibitor	99.66%
Inarigivir soproxil (SB9200) is an agonist of innate immunity and shows potent antiviral activity against resistant HCV variants, with EC₅₀s of 2.2 and 1.0 μM for HCV 1a/1b in cells of genotype 1 HCV replicon systems. Inarigivir soproxil, an orally bioavailable proagent of SB 9000, has broad-spectrum antiviral activity against RNA viruses including HCV, norovirus, respiratory syncytial virus and influenza and HBV.

Name
Email *

	Sorry, but the email address you supplied was invalid.

HBV

HBV

HBV Related Products (371)

Antibodies (2)

HBV Related Products (371):