51 Results for "

location

" in MedChemExpress (MCE) Product Catalog:
Products (51)

51 Results for "location" in MCE Product Catalog:

4
4 Cited Publications
Cat. No.: HY-B1422
CAS No.: 90-45-9
Synonyms: Aminacrine
9-Aminoacridine, a fluorescent probe, acts as an indicator of pH for quantitative determination of transmembrane pH gradients (inside acidic). 9-Aminoacridine is an antimicrobial. 9-Aminoacridine exerts its antimicrobial activity by interacting with specific bacterial DNA and disrupting the proton motive force in K. pneumoniae. 9-Aminoacridine is a HIV-1 inhibitor and inhibits HIV LTR transcription highly dependent on the presence and location of the amino moiety. 9-Aminoacridine inhibits virus replication in HIV-1 infected cell lines. 9-Aminoacridine is used as a Rifampin (RIF; HY-B0272) adjuvant for the multidrug-resistant K. pneumoniae infections .
loading...
    loading...
3
3 Cited Publications
Cat. No.: HY-D1727
Target:  

Fluorescent Dye

Research Areas:  

Others

CellTracker Red CMTPX is a cell-permeable fluorescent dye that can be used as a cell tracer for monitoring cell movement and location (Ex/Em=586/614 nm) .
loading...
    loading...
Cat. No.: HY-D2865
Celltrack Deep Red is a fluorescent dye with a fluorescence signal that can be maintained for at least 72 h and has good stability. Celltrack Deep Red can be used for cell tracing and multi-generation cell movement tracking. Within a cell population, Celltrack Deep Red is only transferred to daughter cells and not to neighboring cells (Ex/Em = 630/650 nm) .
loading...
    loading...
Cat. No.: HY-D0996
CAS No.: 181885-68-7
Lds-751 is a nucleic acid stain that mainly detects DNA. Lds-751 is a nucleic acid stain that mainly detects DNA. Lds-751 has a high affinity for DNA and fluorescence is enhanced after binding, but the maximum emission wavelength is 670nm. Lds-751 and Thiazole orange can be used for the differentiation of red blood cells, platelets, reticulocytes, and nucleated cells and can be stimulated at 488nm. Studies have shown that LDS-751 binds almost exclusively to mitochondria when incubated with nucleated living cells. After nucleated Acridine Orange (HY-101879) staining and LDS-751 treatment of cells, confocal microscopy revealed almost no co-location of the cells. Staining with Rhodamine 123 (HY-D0816), a dye known to bind polarized mitochondria, was almost identical to the pattern observed with LDS-751 .
loading...
    loading...
Cat. No.: HY-N7058
CAS No.: 488-10-8
Cis-Jasmone is a plant-derived natural product. Cis-Jasmone is constitutively released by many flowers and sometimes by leaves as an attractant for pollinators or as a chemical cue for host location by insect flower herbivores. Cis-Jasmone treatment of crop plants not only induces direct defense against herbivores, but also induces indirect defense by releasing VOCs that attract natural enemies .
loading...
    loading...
Cat. No.: HY-D1569
CAS No.: 3031711-06-2
CellTracker Orange CMRA Dye is a fluorescent dye. CellTracker Orange CMRA Dye can be used for cell imaging and monitoring the movement and location of cells .
loading...
    loading...
Cat. No.: HY-D1871
CAS No.: 1838643-41-6
Cy3 maleimide chloride is a dye derivative of Cyanine 3 (Cy3) (HY-D0822) containing maleimide functional groups. Cy3 is a fluorescent dye with a fluorescence spectrum typically in the green to orange wavelength range. The alkyne functional group of Cy3 maleimide chloride can undergo a "thiol-acrylamide" reaction with molecules containing sulfur-oxygen functional groups to form covalent bonds. Cy3 maleimide chloride can bind to biological molecules such as proteins and antibodies to track their location and dynamic changes in biological samples.
loading...
    loading...
Cat. No.: HY-NP037
Avidin-HRP is Horseradish Peroxidase (HRP) Avidin. Avidin has excellent affinity with biotin and is often used in combination with biotin for immunoassays to detect the location of antigens in tissues .
loading...
    loading...
Cat. No.: HY-D1865
CAS No.: 25470-94-4
Cy3 dimethyl iodide is a dye derivative of Cyanine 3 (Cy3) (HY-D0822) with a dimethyl group in the iodide salt form. The iodide salt form increases the water solubility of the compound, making it suitable for use in aqueous solutions. Cy3 is a near-infrared fluorescent dye commonly used in biolabeling and cell imaging. Cy3 dimethyl iodide binds to biomolecules such as proteins and antibodies to track their location and dynamic changes in biological samples.
loading...
    loading...
Cat. No.: HY-D1272
CAS No.: 2183440-43-7
Synonyms: Sulfo-Cyanine3 amine
Sulfo-Cy3 amine is a dye derivative of Cyanine 3 (Cy3) (HY-D0822) bearing an amine group. The sulfonate ion increases the water solubility of the compound, making it suitable for use in aqueous solutions. Cy3 is a fluorescent dye with a fluorescence spectrum typically in the green to orange wavelength range. The amine functionality of Sulfo-Cy3 amine can react with carboxyl groups to form covalent bonds. Sulfo-Cy3 amine can bind to biological molecules such as proteins and antibodies to track their location and dynamic changes in biological samples.
loading...
    loading...
Cat. No.: HY-NP043
Avidin-Cy3 is Cy3-labeled Avidin. Avidin has excellent affinity with biotin and is often used in combination with biotin for immunoassays to detect the location of antigens in tissues .
loading...
    loading...
Cat. No.: HY-W075353
CAS No.: 35218-75-8
Target:  

Fluorescent Dye MOFs

Research Areas:  

Cancer

TPPS can be used as a non-cytotoxic probe for detecting tumor location .
loading...
    loading...
Cat. No.: HY-141631
CAS No.: 155575-01-2
Synonyms: L-α-Phosphatidylcholine
Dihomo-γ-Linolenoyl PAF C-16is a PAFanalogue, it is in sn-2location contains dihomo-γ-linolenoate, instead of PAF C-16The acetate part in .
loading...
    loading...
Inactive ASO (in vivo) sodium
0 Images
CCTATAGGACTATCCAGGAA
Cat. No.: HY-153734
Purity:  92.18%
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
loading...
    loading...
Cat. No.: HY-D1585
CAS No.: 150152-63-9
BODIPY TR methyl ester is a lipophilic GFP Counterstain. BODIPY TR methyl ester dye readily permeates cell membranes and localizes in endomembranous organelles but not localize strongly in plasma membranes. BODIPY TR methyl ester is an excellent red fluorescent vital dye (Ex=568 nm, Em=625 nm), can be used to reveal the location and shapes of cell nuclei, the shapes of cells within embryonic tissues, as well as the bound aries of organ-forming tissues within the whole embryo .
loading...
    loading...
Cat. No.: HY-N7058R
CAS No.: 488-10-8
cis-Jasmone (Standard) is the analytical standard of cis-Jasmone. This product is intended for research and analytical applications. Cis-Jasmone is a plant-derived natural product. Cis-Jasmone is a plant-derived natural product. Cis-Jasmone is constitutively released by many flowers and sometimes by leaves as an attractant for pollinators or as a chemical cue for host location by insect flower herbivores. Cis-Jasmone treatment of crop plants not only induces direct defense against herbivores, but also induces indirect defense by releasing VOCs that attract natural enemies .
loading...
    loading...
Cat. No.: HY-153369
CAS No.: 1609342-18-8
Synonyms: BAY 1165747
BAY-747 (BAY 1165747) is an orally active and brain-penetrant stimulator of soluble guanylate cyclase (sGC). BAY-747 reverses L-NAME induced memory impairments and enhances cognition of rats in the object location task (OLT). BAY-747 also decreases blood pressure in both conscious normotensive and spontaneously hypertensive rats (SHR). BAY-747 improves function of the skeletal muscle associated with Duchenne muscular dystrophy (DMD) in mdx/mTRG2 mice model .
loading...
    loading...
Cat. No.: HY-103336
CAS No.: 1186195-59-4
Synonyms: T1117
Research Areas:  

Cardiovascular Disease

Tocrifluor 1117 (T1117), a fluorescent form of the cannabinoid CB1 receptor antagonist AM251 (HY-15443), is a selective fluorescent GPR55 ligand. Tocrifluor 1117 is a potent tool for identifying the cellular location of cannabinoid receptors (including GPR55 in living tissues) (Ex/Em=543/590 nm) .
loading...
    loading...
Cat. No.: HY-D2242
Sulfo-Cy7.5 DBCO is a dye derivative of Cyanine 7.5 (Cy7.5) (HY-D0926) bearing a DBCO group. The sulfonate ion increases the water solubility of the compound, making it suitable for use in aqueous solutions. Sulfo-Cy7.5 DBCO can bind to biomolecules such as proteins and antibodies to track their location and dynamic changes in biological samples .
loading...
    loading...
Cat. No.: HY-D1860
Cy3 alkyne chloride is a dye derivative of Cyanine 3 (Cy3) (HY-D0822) containing a sulfonate ion and an alkyne functional group. Cy3 is a fluorescent dye with a fluorescence spectrum typically in the green to orange wavelength range. The alkyne functional group of Cy3 alkyne chloride can react with molecules containing the azide functional group to form covalent bonds. Cy3 alkyne chloride can bind to biological molecules such as proteins and antibodies to track their location and dynamic changes in biological samples.
loading...
    loading...