Antisense Oligonucleotides
Antisense Oligonucleotides (ASOs) usually refer to short, synthetic, single-stranded DNA or RNA (13-30 nucleotides). Following binding to the targeted mRNA or pre-mRNA, ASOs modulates RNA function by several different mechanisms.
1. ASOs can form an RNA–DNA hybrid that becomes a substrate for RNase H, resulting in target mRNA degradation.
2. ASOs can modulate gene expression via steric block of the ribosomal machinery, which can lead to reduced expression, modulation of splicing and/or restoration of a functional protein.
3. Binding of ASOs to pre-mRNA can alter splicing factor recruitment and regulate splicing events.
The first in vivo applications of ASOs showed limited clinical potential because of the high susceptibility of ASOs with an unmodified phosphoribose backbone to rapid degradation by endonucleases and exonucleases. The modifications in backbone, and sugar molecules give ASOs more affinity and stability. Phosphorodiamidate morpholino oligomers (PMO) are very resistant to nuclease and protease degradation and are mostly used in splicing modulation or translation inhibition. Chemical modifications at 2' position of ribose sugar ring such as 2’-O-methyl (2’-O-me), 2’-Fluoro (2’-F), 2’-O-methoxyethyl (2’-MOE) allow oligonucleotide to adopt RNA like C3’-endo sugar pucker, making it thermally stable.
- Molecular Weight: 13-20 (KDa)
Defibrotide sodium is a complex mixture of single stranded polydeoxyribonucleotides. Defibrotide sodium has liver protection, anti-inflammatory, antithrombotic, profibrinolytic, and anti-ischemic properties. Defibrotide sodium can be used for sinusoidal obstruction syndrome (SOS)/veno-occlusive disease (VOD) research.
- Molecular Weight: 6530.30
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch.
- Molecular Weight: 4967 (free acid)
- Molecular Weight: 6481.3 (free acid)
Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion.
- Formula: C211H256N76Na19O119P19S19
- Molecular Weight: 6978 (free acid)
Drisapersen sodium, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
- Molecular Weight: 8684.86 (free acid)
Olezarsen (ISIS 678354;IONIS-APOCIII-LRx) sodium is a GalNAc-modified antisense oligonucleotide. Olezarsen sodium binds to APOC3 mRNA and induces its degradation via ribonuclease H1-mediated sense strand cleavage, thereby reducing hepatic apolipoprotein C-III (apoC-III) synthesis. Olezarsen sodium reduces plasma triglyceride, apolipoprotein B and non-high-density lipoprotein cholesterol levels. Olezarsen sodium is applicable to research related to familial chylomicronemia syndrome, hypertriglyceridemia and atherosclerotic cardiovascular disease.
- Molecular Weight: 7283.9 (free acid)
ISIS 104838 sodium is an antisense oligonucleotide targeting TNF-α. ISIS 104838 sodium specifically binds to human TNF-α mRNA via Watson-Crick base pairing to form a DNA:RNA hybrid duplex, thereby recruiting the ubiquitously expressed intracellular enzyme RNase H to degrade the target mRNA and inhibit TNF-α protein synthesis at the transcriptional level. ISIS 104838 sodium induces moderate, self-limiting thrombocytopenia in cynomolgus monkeys. ISIS 104838 sodium can be used for the study of inflammatory diseases.
- Formula: C172H204N62Na17O91P17S17
- Molecular Weight: 5684.61 (free acid)
Oblimersen sodium is a BCL-2 inhibitor targeting BCL-2 RNA. Oblimersen sodium specifically binds to the first six codons of the bcl-2 mRNA sequence, resulting in degradation of bcl-2 mRNA and induces apoptosis by down-regulating expression of Bcl-2. Oblimersen sodium can be used for cancer research.
- Molecular Weight: 6430.52 (free acid)
Scrambled IONIS-MAPTRx (sodium) is a scrambled sequence of IONIS-MAPTRx sodium (HY-132582C). Scrambled IONIS-MAPTRx (sodium) has the same amino acid composition as the active IONIS-MAPTRx sodium fragment, but the sequence is randomly scrambled. Scrambled IONIS-MAPTRx (sodium) is typically used as a negative control. Scrambled IONIS-MAPTRx (sodium) has potential for studying Alzheimer's disease.
- Molecular Weight: 54656 (Approximately)
Olaptesed pegol (NOX-A12) is a L-oligoribonucleotide aptamer targeting CXCL12 based on a pegylated structure. Olaptesed pegol neutralizes CXCL12, and CXCL12 inhibition mobilizes chronic lymphocytic leukemia cells into the circulation and prevents their homing into the protective microenvironment. Olaptesed pegol can enhances the infiltration of human primary T cells and NK cells and inhibit tumor growth companied with anti-PD-1 antibody. Olaptesed pegol can be used for researches of colon cancer and lymphocytic leukemia.
- Molecular Weight: 5355.77
AZD8701 (IONIS-1063734) is an antisense oligonucleotide targeting FOXP3 in regulatory T cells (Tregs), with a human IC50 of 65.2 nM. AZD8701 binds to intronic sites of all FOXP3 pre-mRNA isoforms and mediates dose-dependent FOXP3 knockdown via free uptake. AZD8701 can be used in cancer-related research.
- Formula: C95H107F3N32Na8O50P8S8
- Molecular Weight: 3066.4 (free acid)
Farabursen sodium (RGLS8429 sodium; RG1015 sodium) is a miR-17 inhibitor. Farabursen sodium inhibits the function of the miR-17 family, relieves the inhibitory effect on miR-17 target genes including PKD1 and PKD2, and increases the level of PC1/2. Farabursen sodium slows the growth of renal cysts, reduces the ratio of kidney weight to body weight, and decreases the cyst index and proliferation index. Farabursen sodium is applicable to research related to autosomal dominant polycystic kidney disease.
- Molecular Weight: 7619.00
TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
- Molecular Weight: 5616.00
- Molecular Weight: 7164 (free acid)
- Formula: C296H436N80O155P20S13
- Molecular Weight: 8631.38
- Molecular Weight: 7183.1 (free acid)
IONIS-DGAT 2Rx (ION-224) sodium is a DGAT2 inhibitor, which is promising for research of atherosclerosis.
- Formula: C204H235N63Na19O109P19S19
- Molecular Weight: 6530.3 (free acid)
Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch.
- Molecular Weight: 7197.26 (free acid)
Zorevunensen (STK-001) negative control is the negative control form of Zorevunensen (HY-148410). Zorevunensen is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen is used for the study of Dravet syndrome.
- Molecular Weight: 5480.52 (free acid)
Opemalirsen sodium is an antisense oligonucleotide targeted to apolipoprotein L1 (APOL1). It is used for the study of Kidney disorders.
