Search Result

Results for "

messenger

" in MedChemExpress (MCE) Product Catalog:

By Targets:	mRNA (5) Akt (2) Apoptosis (6) Autophagy (2) Bacterial (3) Bcl-2 Family (1) Biochemical Assay Reagents (8) Calcium Channel (18) Caspase (1) CDK (1) Cyclic GMP-AMP Synthase (3) DNA/RNA Synthesis (5) Drug Derivative (3) Drug Metabolite (1) Endogenous Metabolite (42) Endonuclease (1) Environmental Pollutants (1) ERK (3) Factor Xa (3) FGFR (1) Fluorescent Dye (2) Fungal (1) Glycosidase (2) Guanylate Cyclase (1) HBV (2) Heme Oxygenase (HO) (2) Histone Methyltransferase (2) HSP (2) Influenza Virus (5) Isotope-Labeled Compounds (8) JNK (1) Liposome (3) LPL Receptor (2) Mitochondrial Metabolism (2) mTOR (1) NO Synthase (1) Nucleoside Antimetabolite/Analog (2) p38 MAPK (1) Parasite (2) Phosphatase (1) Phosphodiesterase (PDE) (2) Phospholipase (1) PI3K (2) PKA (3) PKC (3) Reactive Oxygen Species (ROS) (4) Reference Standards (6) RSV (1) Small Interfering RNA (siRNA) (8) SphK (1) STING (11) Survivin (1) Thrombin (2) Transthyretin (TTR) (2) TRP Channel (3) Tyrosinase (2) Tyrosine Hydroxylase (1)
By Research Areas:	Cancer (23) Cardiovascular Disease (18) Endocrinology (5) Infection (21) Inflammation/Immunology (28) Metabolic Disease (22) Neurological Disease (22)
Oligonucleotides:	Chemokine & Receptors (2) mRNA (5) Phospholipids (1) Cationic Lipids (2) siRNA drugs (8) Antisense Oligonucleotides (4) Gene Editing (2) siRNAs (8) Interleukin & Receptors (1)

115

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

Natural
Products

Isotope-Labeled Compounds

Oligonucleotides

GMP Molecules

Targets Recommended: mRNA

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-108496

Sphingosine-1-phosphate 15+ Cited Publications S1P	Endogenous Metabolite LPL Receptor	Inflammation/Immunology Endocrinology Cancer
Sphingosine-1-phosphate (S1P) is an agonist of S1P_1-5 receptors and a ligand of GPR3, GPR6 and GPR12. Sphingosine-1-phosphate is an intracellular second messenger and mobilizes Ca ²⁺ as an extracellular ligand for G protein-coupled receptors . Sphingosine-1-phosphate is an important lipid mediator generated from Sphingomyelin (HY-113498) or other membrane phospholipids . Sphingosine-1-phosphate stimulates the DNA synthesis, cell proliferation and migration .

HY-B1511

Cyclic AMP 20+ Cited Publications Cyclic adenosine monophosphate; Adenosine cyclic 3', 5'-monophosphate; cAMP	Endogenous Metabolite	Neurological Disease Metabolic Disease Cancer
Cyclic AMP (Cyclic adenosine monophosphate), adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP is an important second messenger in many biological processes .

HY-12512

cGAMP Maximum Cited Publications 26 Publications Verification Cyclic GMP-AMP; 3',3'-cGAMP	STING	Inflammation/Immunology
cGAMP (Cyclic GMP-AMP) functions as an endogenous second messenger in metazoans and triggers interferon production in response to cytosolic DNA. cGAMP activates stimulator of interferon genes (STING), which activates a signaling cascade leading to the production of type I interferons and other immune mediators .

HY-B1511A

Cyclic AMP sodium 20+ Cited Publications Cyclic adenosine monophosphate sodium; Adenosine cyclic 3', 5'-monophosphate sodium; cAMP sodium	Biochemical Assay Reagents	Neurological Disease Metabolic Disease Cancer
Cyclic AMP (Cyclic adenosine monophosphate) sodium, adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP sodium is an important second messenger in many biological processes .

HY-P0063

Copper tripeptide 1 Publications Verification GHK-Cu	Biochemical Assay Reagents	Inflammation/Immunology
Copper tripeptide (GHK-Cu) is a tripeptide. During wound healing, Copper tripeptide may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide is a natural modulator of multiple cllular pathways in skin regeneration .

HY-12326A

c-di-AMP disodium 15+ Cited Publications Cyclic diadenylate disodium; Cyclic-di-AMP disodium	STING Bacterial Endogenous Metabolite	Inflammation/Immunology
c-di-AMP (Cyclic diadenylate) sodium is a STING agonist, which binds to the transmembrane protein STING thereby activating the TBK3-IRF3 signaling pathway, subsequently triggering the production of type I IFN and TNF. c-di-AMP sodium is also a bacterial second messenger, which regulates cell growth, survival, and virulence, primarily within Gram-positive bacteria, and also regulates host immune response. c-di-AMP sodium acts as a potent mucosal adjuvant stimulating both humoral and cellular responses .

HY-112980

Nusinersen 4 Publications Verification	DNA/RNA Synthesis	Neurological Disease
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .

HY-132609

Patisiran sodium 1 Publications Verification	Small Interfering RNA (siRNA) Transthyretin (TTR)	Neurological Disease
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the *transthyretin (TTR) messenger* RNA**. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .

HY-N0086

N6-Methyladenosine 5+ Cited Publications 6-Methyladenosine; N-Methyladenosine	Influenza Virus Endogenous Metabolite	Infection
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-112980A

Nusinersen sodium 4 Publications Verification	DNA/RNA Synthesis	Neurological Disease
Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .

HY-103642A

D-myo-Inositol-1,4,5-triphosphate trisodium 1 Publications Verification Inositol 1,4,5-trisphosphate trisodium; Ins(1,4,5)-P3 trisodium	Calcium Channel	Metabolic Disease
D-myo-Inositol-1,4,5-triphosphate sodium salt is the trisodium salt of D-myo-Inositol 1,4,5-trisphosphate (1,4,5-IP3), which is a second messenger that stimulates the discharge of calcium from the endoplasmic reticulum.

HY-110382

Cyclic-di-GMP disodium 5+ Cited Publications c-di-GMP disodium; cyclic diguanylate disodium; 5GP-5GP disodium	STING Endogenous Metabolite	Cancer
Cyclic-di-GMP disodium is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP disodium has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP disodium can be used in cancer research .

HY-151507

306Oi10 1 Publications Verification	Liposome	Others
306Oi10 is a branched ionizable lipid that can be used to construct lipid nanoparticles (LNPs) for delivering messenger RNA. The surface ionization of lipid nanoparticles is related to the effectiveness of mRNA delivery. The tail of 306Oi10 has a one-carbon branch, which provides it with stronger surface ionization compared to lipids with linear tails, thereby enhancing its mRNA delivery efficacy. 306Oi10 can be used in research related to mRNA delivery .

HY-132610A

Givosiran sodium 1 Publications Verification ALN-AS1 sodium	Small Interfering RNA (siRNA)	Metabolic Disease
Givosiran (ALN-AS1) sodium is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran sodium downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid (ALA) and porphobilinogen (PBG) levels. Givosiran sodium demonstrates potent inhibitory activity against ALAS1 in mouse, rat, and cynomolgus monkey models. Givosiran sodium can be used for the research of acute hepatic porphyria (AHP) .

HY-132610

Givosiran 1 Publications Verification ALN-AS1	Small Interfering RNA (siRNA)	Metabolic Disease
Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid (ALA) and porphobilinogen (PBG) levels. Givosiran demonstrates potent inhibitory activity against ALAS1 in mouse, rat, and cynomolgus monkey models. Givosiran can be used for the research of acute hepatic porphyria (AHP) .

HY-12326

c-di-AMP Cyclic diadenylate; Cyclic-di-AMP	STING Bacterial Endogenous Metabolite	Inflammation/Immunology
c-di-AMP (Cyclic diadenylate) is a STING agonist, which binds to the transmembrane protein STING thereby activating the TBK3-IRF3 signaling pathway, subsequently triggering the production of type I IFN and TNF. c-di-AMP (Cyclic diadenylate) is also a bacterial second messenger, which regulates cell growth, survival, and virulence, primarily within Gram-positive bacteria, and also regulates host immune response. c-di-AMP (Cyclic diadenylate) acts as a potent mucosal adjuvant stimulating both humoral and cellular responses .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-110385

cGAMP disodium Maximum Cited Publications 26 Publications Verification Cyclic GMP-AMP disodium; 3',3'-cGAMP disodium	STING Endogenous Metabolite	Inflammation/Immunology
cGAMP (Cyclic GMP-AMP) disodium functions as an endogenous second messenger in metazoans and triggers interferon production in response to cytosolic DNA. cGAMP diammonium activates stimulator of interferon genes (STING), which activates a signaling cascade leading to the production of type I interferons and other immune mediators .

HY-113337A

Ap4A tetraammonium P1,P4-Di-(adenosine-5')-tetraphosphate tetraammonium	Apoptosis	Cancer
Ap4A tetraammonium (P1,P4-Di-(adenosine-5')-tetraphosphate tetraammonium) is a conserved second messenger in organisms ranging from bacteria to humans. Ap4A tetraammonium binds to the histidine triad nucleotide-binding protein 1 (HINT1) activates the transcription of genes downstream of MITF. Ap4A tetraammonium induces apoptosis .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-N7395

Cyclic ADP-ribose 1 Publications Verification cADPR	Calcium Channel TRP Channel Endogenous Metabolite	Infection Cardiovascular Disease Neurological Disease Inflammation/Immunology Endocrinology
Cyclic ADP-ribose (cADPR) is a potent second messenger for calcium mobilization that is synthesized from NAD ⁺ by an ADP-ribosyl cyclase. Cyclic ADP-ribose increases cytosolic calcium mainly by Ryanodine receptor-mediated release from endoplasmic reticulum and also by extracellular influx through the opening of TRPM2 channels .

HY-173189

2-5A 2′,5′-ApApA; 2′,5′-trioligoadenylate; 5'-O-Triphosphoryladenylyl-(2'→5')-adenylyl-(2'→5')-adenosine	DNA/RNA Synthesis RSV	Infection Cancer
2-5A is a RNase L activator, signal mediator and innate immune second messenger. 2-5A induces the expression of interferons and interferon-stimulated genes in recipient cells in a RNase L-dependent manner. 2-5A inhibits tumor growth in mouse models via paracrine RNase L activation derived from cancer cells. 2-5A can be used in studies related to viral infection and cancer .

HY-128468

1,2-Dimyristoyl-sn-glycerol	Liposome PKC Parasite	Others
1,2-Dimyristoyl-sn-glycerol is a saturated diacylglycerol and a weak second messenger for the activation of PKC .

HY-P2878

Phosphodiesterase I 1 Publications Verification PDE	Phosphodiesterase (PDE)	Neurological Disease Cancer
Phosphodiesterase I (PDE) is an enzyme that can catalyze the hydrolysis of the 3' ring phosphate bond of cyclic nucleotides, and is often used in biochemical research. Phosphodiesterase I acts as an important regulator of signal transduction mediated by the second messenger molecules cAMP and cGMP. According to their specificity to cyclic nucleotides, they can also be divided into different types, such as PDE1-PDE11, which also have certain potential in various diseases .

HY-W416291

Polyadenylic acid potassium Poly(A)	Biochemical Assay Reagents	Cancer
Polyadenylic acid potassium, also known as Poly(A), is enzymatically added to messenger RNA (mRNA) in eukaryotic cells to stabilize mRNAs. Poly(A) is used to evaluate binding on cationic liposomes doped with non-ionic nucleolipids. Poly(A) is used in small molecule mRNA targeted drug development to evaluate the binding of potential therapeutic agents such as the Isoquinoline group of alkaloids. Small molecules that could bind to this poly(A) tail could influence and possibly inhibit mRNA function and subsequent protein production in the cell leading to the development of new type of therapeutic agents.

HY-148123

Glycerophospholipids, cephalins	Biochemical Assay Reagents	Neurological Disease
Glycerophospholipids and cephalins are a class of phospholipid compounds and important components of neural membranes. Glycerophospholipids and cephalins are hydrolysis substrates of phospholipase (such as PLA2, PLC, and PLD). After complete hydrolysis, they produce 1 mol of glycerol, phosphate, ethanolamine, and 2 mol of fatty acids, respectively. Glycerophospholipids and cephalins can maintain membrane structure, fluidity, and ion permeability, and serve as precursors of second messengers such as arachidonic acid and diacylglycerol. Glycerophospholipids and cephalins can regulate signal transduction, cell apoptosis, and membrane transport, and are used in the study of neurodegenerative diseases (such as Alzheimer's disease) .

HY-113469

Cyclic GMP 1 Publications Verification	Endogenous Metabolite	Infection Cardiovascular Disease Inflammation/Immunology
Cyclic GMP (cGMP), an important second messenger, is a major intracellular mediator of extracellular signals such as nitric oxide (NO) and natriuretic peptides (NPs). Effects of Cyclic GMP occur through three main groups of cellular targets: cGMP-dependent protein kinases (PKGs), cGMP-gated cation channels, and PDEs. Cyclic GMP can inhibit both platelet adhesion and aggregation. cGAMP (Cyclic-GMP-AMP) (HY-12512), a conjugate of Cyclic GMP and AMP, can induce IRF3 phosphorylation and nuclear translocation, enhancing antiviral immune responses .

HY-12895

SKI V 1 Publications Verification	SphK PI3K Apoptosis	Cancer
SKI V is a noncompetitive and potent non-lipid sphingosine kinase (SPHK; SK) inhibitor with an IC₅₀ of 2 μM for GST-hSK. SKI V potently inhibits PI3K with an IC₅₀ of 6 μM for hPI3k. SKI V decreases formation of the mitogenic second messenger sphingosine-1-phosphate (S1P). SKI V induces apoptosis and has antitumor activity .

HY-103317A

NAADP tetrasodium	Calcium Channel	Cardiovascular Disease Cancer
NAADP tetrasodium is a second messenger. NAADP tetrasodium releases Ca ²⁺ from acidic endosomes and lysosomes. NAADP tetrasodium can be used to study cancer (such as oral squamous cell carcinoma, malignant melanoma) and angiogenesis-related diseases .

HY-131920A

Polyuridylic acid potassium	DNA/RNA Synthesis	Others
Polyuridylic acid potassium is a polynucleotide. In protein synthesis systems based on active mammalian ribosomes, Polyuridylic acid potassium acts as a specific messenger to induce the biosynthesis of polyphenylalanine, with no effect on the incorporation of non-phenylalanine amino acids. Polyuridylic acid potassium serves as a template to promote the non-enzymatic synthesis of oligoadenylates .

HY-153492A

Olpasiran sodium AMG 890 sodium; ARC-LPA sodium	Small Interfering RNA (siRNA)	Inflammation/Immunology
Olpasiran (AMG 890, ARC-LPA) sodium is an N-acetyl galactosamine (GalNAc)-conjugated, hepatocyte-targeted siRNA. Olpasiran sodium directly inhibits LPA messenger RNA translation in hepatocytes and potently reduce Lp(a) concentration. Olpasiran sodium can be used for the research of cardiovascular disease, such as atherosclerosis .

HY-126076A

VPC-80051	DNA/RNA Synthesis	Cancer
VPC-80051 is an inhibitor of hnRNP A1 splicing activity. VPC-80051 directly interacts with hnRNP A1 RBD and reduces AR-V7 messenger levels in 22Rv1 CRPC cell line. VPC-80051 can be used in prostate cancer research .

HY-107780

Cyclic-di-GMP c-di-GMP; cyclic diguanylate; 5GP-5GP	STING Endogenous Metabolite	Cancer
Cyclic-di-GMP is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP can be used in cancer research .

HY-108496S

Sphingosine-1-phosphate-d7 S1P-d₇	Endogenous Metabolite LPL Receptor	Endocrinology
Sphingosine-1-phosphate-d₇ is the deuterium labeled Sphingosine-1-phosphate. Sphingosine-1-phosphate (S1P) is an agonist of S1P1-5 receptors and a ligand of GPR3, GPR6 and GPR12.?Sphingosine-1-phosphate is an intracellular second messenger and mobilizes Ca2+ as an extracellular ligand for G protein-coupled receptors . Sphingosine-1-phosphate is an important lipid mediator generated from Sphingomyelin (HY-113498) or other membrane phospholipids .

HY-B1511R

Cyclic AMP (Standard) Cyclic adenosine monophosphate (Standard); Adenosine cyclic 3', 5'-monophosphate (Standard); cAMP (Standard)	Endogenous Metabolite Reference Standards	Cancer
Cyclic AMP (Standard) is the analytical standard of Cyclic AMP. Cyclic AMP (Cyclic adenosine monophosphate), adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP is an important second messenger in many biological processes .

HY-W010410

Oct-1-en-3-ol	Environmental Pollutants	Neurological Disease Metabolic Disease
Oct-1-en-3-ol, a fatty acid fragrant, is a self-stimulating oxylipin messenger. Oct-1-en-3-ol serves as a signaling molecule in plant cellular responses, plant-herbivore interactions, and plant-plant interactions. Oct-1-en-3-ol causes dopamine neuron degeneration through disruption of dopamine handling .

HY-103317

NAADP	Nucleoside Antimetabolite/Analog	Inflammation/Immunology
NAADP, a nucleotide, is a Ca ²⁺-mobilizing second messenger. NAADP is essential for initiation of Ca ²⁺ signaling .

HY-150224

GalNAc unconjugated/naked Fitusiran sodium	Small Interfering RNA (siRNA) Factor Xa	Others
GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets *antithrombin (AT) messenger* RNA** to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .

HY-114208A

BI-9321 trihydrochloride	Histone Methyltransferase	Cancer
BI-9321 trihydrochloride is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a K_d value of 166 nM. BI-9321 trihydrochloride is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 trihydrochloride specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC₅₀ of 1.2 μM in U2OS cells .

HY-153609

AS-Patisiran sodium	Transthyretin (TTR) Small Interfering RNA (siRNA)	Neurological Disease
AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the *transthyretin (TTR) messenger* RNA**. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .

HY-107780B

Cyclic-di-GMP diammonium 5+ Cited Publications c-di-GMP diammonium; cyclic diguanylate diammonium; 5GP-5GP diammonium	STING Endogenous Metabolite	Cancer
Cyclic-di-GMP diammonium is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP diammonium has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP diammonium can be used in cancer research .

HY-N0086S

N6-Methyladenosine-d3 6-Methyladenosine-d₃; N-Methyladenosine-d₃	Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite	Infection
N6-Methyladenosine-d₃ (6-Methyladenosine-d₃; N-Methyladenosine-d₃) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-12326B

c-di-AMP diammonium 15+ Cited Publications Cyclic diadenylate diammonium; Cyclic-di-AMP diammonium	STING Bacterial Endogenous Metabolite	Inflammation/Immunology
c-di-AMP diammonium is a STING agonist, which binds to the transmembrane protein STING thereby activating the TBK3-IRF3 signaling pathway, subsequently triggering the production of type I IFN and TNF. c-di-AMP diammonium is also a bacterial second messenger, which regulates cell growth, survival, and virulence, primarily within Gram-positive bacteria, and also regulates host immune response. c-di-AMP diammonium acts as a potent mucosal adjuvant stimulating both humoral and cellular responses .

HY-113469A

Cyclic GMP sodium 1 Publications Verification	Endogenous Metabolite	Infection Cardiovascular Disease Inflammation/Immunology
Cyclic GMP (cGMP) sodium, an important second messenger, is a major intracellular mediator of extracellular signals such as nitric oxide (NO) and natriuretic peptides (NPs). Effects of Cyclic GMP sodium occur through three main groups of cellular targets: cGMP-dependent protein kinases (PKGs), cGMP-gated cation channels, and PDEs. Cyclic GMP can inhibit both platelet adhesion and aggregation. cGAMP (Cyclic-GMP-AMP) (HY-12512), a conjugate of Cyclic GMP and AMP, can induce IRF3 phosphorylation and nuclear translocation, enhancing antiviral immune responses .

HY-N7395A

Cyclic ADP-ribose ammonium 1 Publications Verification cADPR ammonium	Calcium Channel TRP Channel Endogenous Metabolite	Infection Cardiovascular Disease Neurological Disease Inflammation/Immunology Endocrinology
Cyclic ADP-ribose ammonium (cADPR ammonium) is a potent second messenger for calcium mobilization that is synthesized from NAD ⁺ by an ADP-ribosyl cyclase. Cyclic ADP-ribose ammonium increases cytosolic calcium mainly by Ryanodine receptor-mediated release from endoplasmic reticulum and also by extracellular influx through the opening of TRPM2 channels .

HY-128465

1,2-Dilauroyl-sn-glycerol	Endogenous Metabolite	Others
1,2-Dilauroyl-sn-glycerol is a saturated diacylglycerol and may play a role in second messenger signal transduction .

HY-174646

Human IL10 mRNA	mRNA	Inflammation/Immunology
Human IL10 mRNA is the messenger ribonucleic acid that encodes human IL-10. The expression of IL-10 mRNA is highly inducible and cell type-specific.

HY-153238

AN15368	Parasite	Infection
AN15368 is an orally active small-molecule precursor that can be activated by parasite carboxypeptidase to produce a compound that targets the messenger RNA processing pathway in T. cruzi. cruzi. AN15368 has the potential to prevent and research Chagas disease potential .

HY-103642

D-myo-Inositol 1,4,5-trisphosphate hexapotassium salt 1 Publications Verification Inositol 1,4,5-trisphosphate hexapotassium salt; Ins(1,4,5)-P3 hexapotassium salt	Calcium Channel	Metabolic Disease
D-myo-Inositol 1,4,5-trisphosphate hexapotassium salt is the hexapotassium salt of D-myo-Inositol 1,4,5-trisphosphate (1,4,5-IP3), which is a second messenger that stimulates the discharge of calcium from the endoplasmic reticulum.

HY-101175

3-Bromo-7-nitroindazole 1 Publications Verification	NO Synthase	Neurological Disease Metabolic Disease
3-Bromo-7-nitroindazole is a potent and selective inhibitor of neuronal nitric oxide synthase (nNOS). 3-Bromo-7-nitroindazole affects the intercellular messenger nitric oxide (NO) synthesis throughout the body and brain. 3-Bromo-7-nitroindazole can be used for the researches of metabolic and neurological disease, such as diabetes, stroke and depression .

Cat. No.	Product Name

HY-L240

Plant Hormone Library

45 compounds

Plant hormones are natural signaling molecules synthesized by plants themselves, serving as crucial chemical messengers that exert physiological effects on plants at extremely low concentrations. They coordinate cellular growth, division, differentiation, and organ formation, helping plants adapt to environmental changes. Major categories include abscisic acid, auxins, gibberellins, cytokinins, ethylene, and brassinosteroids, among others.

MCE has included 45 plant hormones, which can be used for identification in plant metabolomics and related botanical research.

HY-L186

Neurotransmitter Compound Library

58 compounds

Neurotransmitters are chemical messengers that allows a neuron's electrical signal to pass to a postsynaptic neuron or effect target. Neurotransmitters include amino acids, monoamines, and peptides, while other neurotransmitters are composed of metabolites such as nitric oxide and carbon monoxide. The function of neurotransmitters is closely related to the disease of life, helping to regulate the body's heartbeat, blood pressure, breathing, sleep, aging and muscle activity. Therefore, research based on neurotransmitters can help to increase human understanding of diseases.

MCE collects and organizes 58 neurotransmitters and is a tool library for drug screening and mechanism research.

HY-L006

GPCR/G Protein Compound Library

3,389 compounds

GPCRs are a large family of cell surface receptors that respond to a variety of external signals. Binding of a signaling molecule to a GPCR results in G protein activation, which in turn triggers the production of any number of second messengers. GPCRs play an important role in the human body, and increased understanding of these receptors has greatly affected modern medicine. In fact, researchers estimate that between one-third to one-half of all approved drugs act by binding to GPCRs. GPCRs are a large group of drug targets in drug discovery.

MCE provides a unique collection of 3,389 small molecules targeting GPCRs that can be used in the screening for various GPCRs-related research and drug development projects.

HY-L047

Endocrinology Compound Library

1,050 compounds

The endocrine system is a chemical messenger system comprising feedback loops of the hormones released by internal glands of an organism directly into the circulatory system, regulating distant target organs. Hormones are chemicals that serve to communicate between organs and tissues for physiological regulation and behavioral activities. Hormones affect distant cells by binding to specific receptor proteins in the target cell, resulting in a change in cell function.

The endocrine system is concerned with the integration of developmental events proliferation, growth, and differentiation, and the psychological or behavioral activities of metabolism, growth and development, tissue function, sleep, digestion, respiration, excretion, mood, stress, lactation, movement, reproduction, and sensory perception caused by hormones. Irregulated hormone release, inappropriate response to signaling or lack of a gland can lead to endocrine disease.

MCE offers a unique collection of 1,050 endocrinology related compounds targeting varieties of hormone receptors such as thyroid hormone receptor, TSH receptor, GNRH receptor, adrenergic receptor, etc. MCE Endocrinology Compound Library is a useful tool for the discovery of endocrinology drugs.

HY-L062

Neurotransmitter Receptor Compound Library

2,495 compounds

Neurotransmitter (NT) receptors, also known as neuroreceptors, are a broadly diverse group of membrane proteins that bind neurotransmitters for neuronal signaling. There are two major types of neurotransmitter receptors: ionotropic and metabotropic. Ionotropic receptors are ligand-gated ion channels, meaning that the receptor protein includes both a neurotransmitter binding site and an ion channel. The binding of a neurotransmitter molecule (the ligand) to the binding site induces a conformational change in the receptor structure, which opens, or gates, the ion channel. The term “metabotropic receptors” is typically used to refer to transmembrane G-protein-coupled receptors. Metabotropic receptors trigger second messenger-mediated effects within cells after neurotransmitter binding.

In some neurological diseases, the neurotransmitter receptor itself appears to be the target of the disease process. Many neuroactive drugs act by modifying neurotransmitter receptors. A better understanding of neurotransmitter receptor changes in disease may lead to improvements in therapy.

MCE designs a unique collection of 2,495 compounds targeting a variety of neurotransmitter receptors. MCE Neurotransmitter Receptor Compound Library is a useful tool for neurological diseases drug discovery.

HY-L165

Dopamine Receptor Compound Library

267 compounds

Dopamine receptor (DAR), widely distributed in the brain, plays a key role in regulating motor function, motivation, driving force and cognition. The role of DA is mediated by D1-type (D1, D5) and D2-type receptors (D2S, D2L, D3, D4), which are distributed in presynaptic, postsynaptic and extrasynaptic, projection neurons and interneurons. Each receptor has a different function. D1 and D5 receptors couple with G stimulation sites and activate Adenylyl cyclase. The activation of Adenylyl cyclase leads to the production of the second messenger cAMP, which leads to the production of protein kinase A (PKA), which leads to further transcription in the nucleus. D2 to D4 receptors are coupled to G inhibitory sites to inhibit adenylyl cyclase and activate potassium Ion channel. These receptors utilize phosphorylation cascades or direct membrane interactions to affect the functions of voltage-gated and neurotransmitter-gated channels, cytoplasmic enzymes, and transcription factors. Dopamine receptor plays an important role in daily life.

MCE designs a unique collection of 267 small molecules related to dopamine receptor. It is a good tool for screening drugs from nervous system disease.

Cat. No.	Product Name	Type

HY-B1511G

Cyclic AMP

Cyclic adenosine monophosphate; Adenosine cyclic 3', 5'-monophosphate; cAMP

Fluorescent Dye

Cyclic AMP (GMP) (Cyclic adenosine monophosphate (GMP)) is Cyclic AMP (HY-B1511) produced by using GMP guidelines. GMP small molecules works appropriately as an auxiliary reagent for cell therapy manufacture. Cyclic AMP (Cyclic adenosine monophosphate), adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP is an important second messenger in many biological processes .

HY-D3416

TMR-DN TAMRA-2,4-dinitroaniline	Fluorescent Dye
TMR-DN (TAMRA-2,4-dinitroaniline) is a bright orange fluorescent probe that binds to the SRB-2 aptamer, with a K_d value of 35 nM for the SRB-2 aptamer. TMR-DN exhibits low background fluorescence, enabling wash-free live-cell RNA imaging .

Cat. No.	Product Name	Type

HY-B1511A

Cyclic AMP sodium 20+ Cited Publications Cyclic adenosine monophosphate sodium; Adenosine cyclic 3', 5'-monophosphate sodium; cAMP sodium	Biochemical Assay Reagents
Cyclic AMP (Cyclic adenosine monophosphate) sodium, adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP sodium is an important second messenger in many biological processes .

HY-151507

306Oi10

1 Publications Verification

Biochemical Assay Reagents

306Oi10 is a branched ionizable lipid that can be used to construct lipid nanoparticles (LNPs) for delivering messenger RNA. The surface ionization of lipid nanoparticles is related to the effectiveness of mRNA delivery. The tail of 306Oi10 has a one-carbon branch, which provides it with stronger surface ionization compared to lipids with linear tails, thereby enhancing its mRNA delivery efficacy. 306Oi10 can be used in research related to mRNA delivery .

HY-141572

1,2-Dioleoyl-sn-glycerol

sn-1,2-Dioleoylglycerol; 18:1/18:1-DG

Biochemical Assay Reagents

1,2-Dioleoyl-sn-glycerol (sn-1,2-Dioleoylglycerol; 18:1/18:1-DG) is a glycerolipid located on the plasma membrane. 1,2-Dioleoyl-sn-glycerol consists of two fatty acid chains covalently linked to a single glycerol molecule by means of an ester bond. 1,2-Dioleoyl-sn-glycerol is an analog of the protein kinase C-activating second messenger DAG. 1,2-Dioleoyl-sn-glycerol has been used as a source of diacylglycerol in the diacylglycerol O-acyltransferase 1 (DGAT1) assay. 1,2-Dioleoyl-sn-glycerol can induce acrosome reaction in human sperm .

HY-128468

1,2-Dimyristoyl-sn-glycerol	Biochemical Assay Reagents
1,2-Dimyristoyl-sn-glycerol is a saturated diacylglycerol and a weak second messenger for the activation of PKC .

HY-148123

Glycerophospholipids, cephalins

Biochemical Assay Reagents

Glycerophospholipids and cephalins are a class of phospholipid compounds and important components of neural membranes. Glycerophospholipids and cephalins are hydrolysis substrates of phospholipase (such as PLA2, PLC, and PLD). After complete hydrolysis, they produce 1 mol of glycerol, phosphate, ethanolamine, and 2 mol of fatty acids, respectively. Glycerophospholipids and cephalins can maintain membrane structure, fluidity, and ion permeability, and serve as precursors of second messengers such as arachidonic acid and diacylglycerol. Glycerophospholipids and cephalins can regulate signal transduction, cell apoptosis, and membrane transport, and are used in the study of neurodegenerative diseases (such as Alzheimer's disease) .

HY-131920A

Polyuridylic acid potassium

Biochemical Assay Reagents

Polyuridylic acid potassium is a polynucleotide. In protein synthesis systems based on active mammalian ribosomes, Polyuridylic acid potassium acts as a specific messenger to induce the biosynthesis of polyphenylalanine, with no effect on the incorporation of non-phenylalanine amino acids. Polyuridylic acid potassium serves as a template to promote the non-enzymatic synthesis of oligoadenylates .

HY-W795960

D-myo-Inositol 1,4,5-trisphosphate sodium salt

Biochemical Assay Reagents

D-myo-inositol 1,4,5-trisphosphate sodium salt is a widely distributed intracellular second messenger. D-myo-inositol 1,4,5-trisphosphate sodium salt acts as a potent agonist of the Ins (1,4,5) P₃ receptor with an EC₅₀ of 0.12 μM and inhibits bovine PLC-δ1, with an IC₅₀ of 5.4 μM for binding and an IC₅₀ of 12.4 μM for hydrolysis. D-myo-inositol 1,4,5-trisphosphate sodium saltis metabolized into Ins (1,4) P₂ and Ins (1,3,4,5) P₄. D-myo-inositol 1,4,5-trisphosphate sodium salt mediates various cellular processes, including growth, development, fertilization, secretion, contraction and neuromodulation. D-myo-inositol 1,4,5-trisphosphate sodium salt inhibits PIP₂ hydrolysis and Ca ²⁺-ATPase activity. D-myo-inositol 1,4,5-trisphosphate sodium salt is used for cardiac preconditioning, exerts cardioprotective effects and mimics ischemic preconditioning. D-myo-inositol 1,4,5-trisphosphate sodium salt is applied in studies related to intracellular calcium and phosphoinositol signaling pathways .

HY-117115

1,2-Dihexanoyl-sn-glycerol	Biochemical Assay Reagents
1,2-Dihexanoyl-sn-glycerol is an analog of protein kinase C (PKC) that activates the second messenger diacylglycerol (DAG). Although the biological activity of 1,2-dicaproyl-sn-glycerol has not been well characterized, it is expected to behave similarly to 1,2-dioctanoyl-sn-glycerol.

HY-W145699

D-myo-Inositol 4-monophosphate

Biochemical Assay Reagents

D-myo-Inositol 4-mono-phosphate, also known as IMP, is a phosphorylated form of inositol that is commonly found in various metabolic pathways, especially in the biosynthesis of phospholipids and cell signaling molecules. D-myo-Inositol 4-mono-phosphate has unique chemical properties that make it an important intermediate in the production of second messengers, such as inositol triphosphate (IP3) and diacylglycerol (DAG), which signal in cells plays a key role in. D-myo-Inositol 4-mono-phosphate is also used in dietary supplements and pharmaceuticals because of its potential health benefits, including improved insulin sensitivity and cognitive function.

HY-B1511G

Cyclic AMP

Cyclic adenosine monophosphate; Adenosine cyclic 3', 5'-monophosphate; cAMP

Biochemical Assay Reagents

Cat. No.	Product Name	Target	Research Area

HY-P0063

Copper tripeptide 1 Publications Verification GHK-Cu	Biochemical Assay Reagents	Inflammation/Immunology
Copper tripeptide (GHK-Cu) is a tripeptide. During wound healing, Copper tripeptide may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide is a natural modulator of multiple cllular pathways in skin regeneration .

HY-P3624

Cenderitide	Guanylate Cyclase	Cardiovascular Disease
Cenderitide is a potent agonist of particulate guanylyl cyclase receptor (pGC). Cenderitide is a natriuretic peptide (NP) composed of C-type natriuretic peptide (CNP) fused to the C-terminus of Dendroaspis natriuretic peptide (DNP). Cenderitide activates both pGC-A and pGC-B, activates the second messenger cGMP, suppresses aldosterone, and preserves GFR without reducing blood pressure. Cenderitide can be used for heart failure research .

HY-P10720

C-Type Natriuretic Peptide (1-53), Porcine, Rat,mouse	Endogenous Metabolite	Cardiovascular Disease
C-Type Natriuretic Peptide (1-53), Porcine, Rat, mouse is an activator of particulate guanylate cyclase B (pGC-B), which is highly expressed in endothelial cells, kidneys, and the heart. C-Type Natriuretic Peptide (1-53), Porcine, Rat, mouse can mediate a potent anti-fibrotic effect in human cardiac and renal fibroblasts by generating the second messenger cGMP .

HY-P1803

Protein Kinase C Peptide Substrate PKCε; PRKCE ; Peptide Epsilon	PKC	Neurological Disease Inflammation/Immunology Endocrinology
Protein Kinase C Peptide Substrate is targeted to a specific cellular compartment in a manner dependent on second messengers and on specific adapter proteins in response to extracellular signals that activate G-protein-coupled receptors, tyrosine kinase receptors, or tyrosine kinase-coupled receptors. Protein Kinase C Peptide Substrate then regulates various physiological functions including the activation of nervous, endocrine, exocrine, inflammatory, and immune systems .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-108496

Sphingosine-1-phosphate 15+ Cited Publications S1P	Classification of Application Fields Ketones, Aldehydes, Acids Endogenous metabolite Disease Research Fields Endocrinology Source Classification	Endogenous Metabolite LPL Receptor
Sphingosine-1-phosphate (S1P) is an agonist of S1P_1-5 receptors and a ligand of GPR3, GPR6 and GPR12. Sphingosine-1-phosphate is an intracellular second messenger and mobilizes Ca ²⁺ as an extracellular ligand for G protein-coupled receptors . Sphingosine-1-phosphate is an important lipid mediator generated from Sphingomyelin (HY-113498) or other membrane phospholipids . Sphingosine-1-phosphate stimulates the DNA synthesis, cell proliferation and migration .

HY-B1511

Cyclic AMP 20+ Cited Publications Cyclic adenosine monophosphate; Adenosine cyclic 3', 5'-monophosphate; cAMP	Structural Classification Natural Products Microorganisms Classification of Application Fields Other Diseases Endogenous metabolite Disease Research Fields Source Classification	Endogenous Metabolite
Cyclic AMP (Cyclic adenosine monophosphate), adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP is an important second messenger in many biological processes .

HY-P0063

Copper tripeptide 1 Publications Verification GHK-Cu	Natural Products Endogenous metabolite Inflammation/Immunology Disease Research Fields Source Classification	Biochemical Assay Reagents
Copper tripeptide (GHK-Cu) is a tripeptide. During wound healing, Copper tripeptide may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide is a natural modulator of multiple cllular pathways in skin regeneration .

HY-12326A

c-di-AMP disodium 15+ Cited Publications Cyclic diadenylate disodium; Cyclic-di-AMP disodium	Natural Products Classification of Application Fields Endogenous metabolite Inflammation/Immunology Disease Research Fields Source Classification	STING Bacterial Endogenous Metabolite
c-di-AMP (Cyclic diadenylate) sodium is a STING agonist, which binds to the transmembrane protein STING thereby activating the TBK3-IRF3 signaling pathway, subsequently triggering the production of type I IFN and TNF. c-di-AMP sodium is also a bacterial second messenger, which regulates cell growth, survival, and virulence, primarily within Gram-positive bacteria, and also regulates host immune response. c-di-AMP sodium acts as a potent mucosal adjuvant stimulating both humoral and cellular responses .

HY-N0086

N6-Methyladenosine 5+ Cited Publications 6-Methyladenosine; N-Methyladenosine	Infection Natural Products Microorganisms Classification of Application Fields Endogenous metabolite Disease Research Fields Source Classification	Influenza Virus Endogenous Metabolite
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-110382

Cyclic-di-GMP disodium 5+ Cited Publications c-di-GMP disodium; cyclic diguanylate disodium; 5GP-5GP disodium	Natural Products Classification of Application Fields Endogenous metabolite Disease Research Fields Source Classification Cancer	STING Endogenous Metabolite
Cyclic-di-GMP disodium is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP disodium has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP disodium can be used in cancer research .

HY-12326

c-di-AMP Cyclic diadenylate; Cyclic-di-AMP	Natural Products Classification of Application Fields Endogenous metabolite Inflammation/Immunology Disease Research Fields Source Classification	STING Bacterial Endogenous Metabolite
c-di-AMP (Cyclic diadenylate) is a STING agonist, which binds to the transmembrane protein STING thereby activating the TBK3-IRF3 signaling pathway, subsequently triggering the production of type I IFN and TNF. c-di-AMP (Cyclic diadenylate) is also a bacterial second messenger, which regulates cell growth, survival, and virulence, primarily within Gram-positive bacteria, and also regulates host immune response. c-di-AMP (Cyclic diadenylate) acts as a potent mucosal adjuvant stimulating both humoral and cellular responses .

HY-110385

cGAMP disodium Maximum Cited Publications 26 Publications Verification Cyclic GMP-AMP disodium; 3',3'-cGAMP disodium	Classification of Application Fields Ketones, Aldehydes, Acids Endogenous metabolite Inflammation/Immunology Disease Research Fields Source Classification	STING Endogenous Metabolite
cGAMP (Cyclic GMP-AMP) disodium functions as an endogenous second messenger in metazoans and triggers interferon production in response to cytosolic DNA. cGAMP diammonium activates stimulator of interferon genes (STING), which activates a signaling cascade leading to the production of type I interferons and other immune mediators .

HY-N7395

Cyclic ADP-ribose 1 Publications Verification cADPR	Cardiovascular Disease Structural Classification Natural Products Neurological Disease Classification of Application Fields Endogenous metabolite Inflammation/Immunology Disease Research Fields Endocrinology Source Classification	Calcium Channel TRP Channel Endogenous Metabolite
Cyclic ADP-ribose (cADPR) is a potent second messenger for calcium mobilization that is synthesized from NAD ⁺ by an ADP-ribosyl cyclase. Cyclic ADP-ribose increases cytosolic calcium mainly by Ryanodine receptor-mediated release from endoplasmic reticulum and also by extracellular influx through the opening of TRPM2 channels .

HY-113469

Cyclic GMP 1 Publications Verification	Natural Products Human Gut Microbiota Metabolites Microorganisms Endogenous metabolite Source Classification	Endogenous Metabolite
Cyclic GMP (cGMP), an important second messenger, is a major intracellular mediator of extracellular signals such as nitric oxide (NO) and natriuretic peptides (NPs). Effects of Cyclic GMP occur through three main groups of cellular targets: cGMP-dependent protein kinases (PKGs), cGMP-gated cation channels, and PDEs. Cyclic GMP can inhibit both platelet adhesion and aggregation. cGAMP (Cyclic-GMP-AMP) (HY-12512), a conjugate of Cyclic GMP and AMP, can induce IRF3 phosphorylation and nuclear translocation, enhancing antiviral immune responses .

HY-107780

Cyclic-di-GMP c-di-GMP; cyclic diguanylate; 5GP-5GP	Microorganisms Classification of Application Fields Ketones, Aldehydes, Acids Metabolic Disease Endogenous metabolite Disease Research Fields Source Classification	STING Endogenous Metabolite
Cyclic-di-GMP is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP can be used in cancer research .

HY-N6606

Delphinidin-3-O-galactoside chloride 1 Publications Verification	Structural Classification Anthocyans Flavonoids Cornaceae Classification of Application Fields Cornus officinalis Sieb. et Zucc. Other Diseases Phenols Polyphenols Plants Disease Research Fields Source Classification	Glycosidase Tyrosinase Heme Oxygenase (HO) HSP
Delphinidin-3-O-galactoside chloride is an anthocyanin found in abbiteye blueberry. Delphinidin-3-O-galactoside chloride show inhibitory activitiesagainst α-glucosidase with an IC₅₀ of 68.33 μM, and tyrosinase with an IC₅₀ of 34.14 μM. Delphinidin-3-O-galactoside chloride attenuates HO-1 and HSP70 messenger RNA down-regulation, suppresses cytotoxicity, reduces endoplasmic reticulum stress responses, scavenges free radicals, reduces intracellular triglyceride levels and lipid droplet accumulation. Delphinidin-3-O-galactoside chloride can be used for the researches of diabesity, melanoma and inflammation .

HY-W010410

Oct-1-en-3-ol	Microorganisms Plants Source Classification	Environmental Pollutants
Oct-1-en-3-ol, a fatty acid fragrant, is a self-stimulating oxylipin messenger. Oct-1-en-3-ol serves as a signaling molecule in plant cellular responses, plant-herbivore interactions, and plant-plant interactions. Oct-1-en-3-ol causes dopamine neuron degeneration through disruption of dopamine handling .

HY-107780B

Cyclic-di-GMP diammonium 5+ Cited Publications c-di-GMP diammonium; cyclic diguanylate diammonium; 5GP-5GP diammonium	Natural Products Classification of Application Fields Metabolic Disease Endogenous metabolite Disease Research Fields Source Classification	STING Endogenous Metabolite
Cyclic-di-GMP diammonium is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP diammonium has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP diammonium can be used in cancer research .

HY-12326B

c-di-AMP diammonium 15+ Cited Publications Cyclic diadenylate diammonium; Cyclic-di-AMP diammonium	Natural Products Classification of Application Fields Endogenous metabolite Inflammation/Immunology Disease Research Fields Source Classification	STING Bacterial Endogenous Metabolite
c-di-AMP diammonium is a STING agonist, which binds to the transmembrane protein STING thereby activating the TBK3-IRF3 signaling pathway, subsequently triggering the production of type I IFN and TNF. c-di-AMP diammonium is also a bacterial second messenger, which regulates cell growth, survival, and virulence, primarily within Gram-positive bacteria, and also regulates host immune response. c-di-AMP diammonium acts as a potent mucosal adjuvant stimulating both humoral and cellular responses .

HY-113469A

Cyclic GMP sodium 1 Publications Verification	Natural Products Classification of Application Fields Endogenous metabolite Inflammation/Immunology Disease Research Fields Source Classification	Endogenous Metabolite
Cyclic GMP (cGMP) sodium, an important second messenger, is a major intracellular mediator of extracellular signals such as nitric oxide (NO) and natriuretic peptides (NPs). Effects of Cyclic GMP sodium occur through three main groups of cellular targets: cGMP-dependent protein kinases (PKGs), cGMP-gated cation channels, and PDEs. Cyclic GMP can inhibit both platelet adhesion and aggregation. cGAMP (Cyclic-GMP-AMP) (HY-12512), a conjugate of Cyclic GMP and AMP, can induce IRF3 phosphorylation and nuclear translocation, enhancing antiviral immune responses .

HY-N0086R

N6-Methyladenosine (Standard) 1 Publications Verification 6-Methyladenosine (Standard); N-Methyladenosine (Standard)	Structural Classification Natural Products Microorganisms Endogenous metabolite Source Classification	Endogenous Metabolite Influenza Virus Reference Standards
N6-Methyladenosine (Standard) is the analytical standard of N6-Methyladenosine. This product is intended for research and analytical applications. N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities. In Vitro: N6-methyladenosine (m6A) is selectively recognized by the human YTH domain family 2 (YTHDF2) protein to regulate mRNA degradation. N6-methyladenosine (m6A), a prevalent internal modification in the messenger RNA of all eukaryotes, is post-transcriptionally installed by m6A methyltransferase (e.g., MT-A70) within the consensus sequence of G(m6A)C (70%) or A(m6A)C (30%). N6-methyladenosine (m6A)-containing RNAs are greatly enriched in the YTHDF-bound portion and diminished in the flow-through portion . N6-methyladenosine (m6A), the most abundant internal RNA modification, functions in diverse biological processes, including regulation of embryonic stem cell self-renewal and differentiation. N6-methyladenosine (m6A) is a large protein complex, consisting in part of methyltransferase-like 3 (METTL3) and methyltransferase-like 14 (METTL14) catalytic subunits .

HY-N7395A

Cyclic ADP-ribose ammonium 1 Publications Verification cADPR ammonium	Cardiovascular Disease Structural Classification Natural Products Neurological Disease Classification of Application Fields Endogenous metabolite Inflammation/Immunology Disease Research Fields Endocrinology Source Classification	Calcium Channel TRP Channel Endogenous Metabolite
Cyclic ADP-ribose ammonium (cADPR ammonium) is a potent second messenger for calcium mobilization that is synthesized from NAD ⁺ by an ADP-ribosyl cyclase. Cyclic ADP-ribose ammonium increases cytosolic calcium mainly by Ryanodine receptor-mediated release from endoplasmic reticulum and also by extracellular influx through the opening of TRPM2 channels .

HY-110385A

cGAMP diammonium Maximum Cited Publications 26 Publications Verification Cyclic GMP-AMP diammonium; 3',3'-cGAMP diammonium	Natural Products Classification of Application Fields Endogenous metabolite Inflammation/Immunology Disease Research Fields Source Classification	STING Endogenous Metabolite
cGAMP (Cyclic GMP-AMP) diammonium functions as an endogenous second messenger in metazoans and triggers interferon production in response to cytosolic DNA. cGAMP diammonium activates stimulator of interferon genes (STING), which activates a signaling cascade leading to the production of type I interferons and other immune mediators .

HY-113337

Ap4A P1,P4-Di-(adenosine-5')-tetraphosphate	Human Gut Microbiota Metabolites Microorganisms Endogenous metabolite Source Classification	Apoptosis
Ap4A (P1,P4-Di-(adenosine-5')-tetraphosphate) is a conserved second messenger in organisms ranging from bacteria to humans. Ap4A binds to the histidine triad nucleotide-binding protein 1 (HINT1) activates the transcription of genes downstream of MITF. Ap4A induces apoptosis .

HY-113469R

Cyclic GMP (Standard)	Structural Classification Natural Products Human Gut Microbiota Metabolites Microorganisms Endogenous metabolite Source Classification	Endogenous Metabolite Reference Standards
Cyclic GMP (Standard) is the analytical standard of Cyclic GMP (HY-113469). This product is intended for research and analytical applications. Cyclic GMP (cGMP), an important second messenger, is a major intracellular mediator of extracellular signals such as nitric oxide (NO) and natriuretic peptides (NPs). Effects of Cyclic GMP occur through three main groups of cellular targets: cGMP-dependent protein kinases (PKGs), cGMP-gated cation channels, and PDEs. Cyclic GMP can inhibit both platelet adhesion and aggregation. cGAMP (Cyclic-GMP-AMP) (HY-12512), a conjugate of Cyclic GMP and AMP, can induce IRF3 phosphorylation and nuclear translocation, enhancing antiviral immune responses .

HY-107780A

Cyclic-di-GMP sodium c-di-GMP sodium; cyclic diguanylate sodium; 5GP-5GP sodium	Microorganisms Classification of Application Fields Ketones, Aldehydes, Acids Metabolic Disease Endogenous metabolite Disease Research Fields Source Classification	STING Endogenous Metabolite
Cyclic-di-GMP sodium is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP sodium has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP sodium can be used in cancer research .

HY-W145699

D-myo-Inositol 4-monophosphate	Natural Products Classification of Application Fields Other Diseases Endogenous metabolite Disease Research Fields Source Classification	Biochemical Assay Reagents Endogenous Metabolite
D-myo-Inositol 4-mono-phosphate, also known as IMP, is a phosphorylated form of inositol that is commonly found in various metabolic pathways, especially in the biosynthesis of phospholipids and cell signaling molecules. D-myo-Inositol 4-mono-phosphate has unique chemical properties that make it an important intermediate in the production of second messengers, such as inositol triphosphate (IP3) and diacylglycerol (DAG), which signal in cells plays a key role in. D-myo-Inositol 4-mono-phosphate is also used in dietary supplements and pharmaceuticals because of its potential health benefits, including improved insulin sensitivity and cognitive function.

HY-W010410R

Oct-1-en-3-ol (Standard)	Microorganisms Plants Source Classification	Reference Standards Others
Methyl ricinoleate (Standard) is the analytical standard of Methyl ricinoleate. This product is intended for research and analytical applications. Methyl ricinoleate is a compound belonging to the group of fatty acid methyl esters. It is derived from ricinoleic acid, a monounsaturated omega-9 fatty acid found in castor oil. Methyl ricinoleate is often used as a reference compound for the analysis of fatty acid methyl esters by gas chromatography. It has also been investigated for its potential use as a biofuel and as an ingredient in the production of biodegradable plastics and surfactants.

HY-113469AR

Cyclic GMP sodium (Standard)	Structural Classification Natural Products Endogenous metabolite Source Classification	Reference Standards Endogenous Metabolite
Cyclic GMP sodium (Standard) is the analytical standard of Cyclic GMP sodium (HY-113469A). This product is intended for research and analytical applications. Cyclic GMP (cGMP) sodium, an important second messenger, is a major intracellular mediator of extracellular signals such as nitric oxide (NO) and natriuretic peptides (NPs). Effects of Cyclic GMP sodium occur through three main groups of cellular targets: cGMP-dependent protein kinases (PKGs), cGMP-gated cation channels, and PDEs. Cyclic GMP can inhibit both platelet adhesion and aggregation. cGAMP (Cyclic-GMP-AMP) (HY-12512), a conjugate of Cyclic GMP and AMP, can induce IRF3 phosphorylation and nuclear translocation, enhancing antiviral immune responses .

HY-N6606R

Delphinidin-3-O-galactoside chloride (Standard)	Structural Classification Anthocyans Flavonoids Cornaceae Cornus officinalis Sieb. et Zucc. Phenols Polyphenols Plants Source Classification	Reference Standards Glycosidase Tyrosinase Heme Oxygenase (HO) HSP
Delphinidin-3-O-galactoside chloride (Standard) is the analytical standard of Delphinidin-3-O-galactoside chloride (HY-N6606). This product is intended for research and analytical applications. Delphinidin-3-O-galactoside chloride is an anthocyanin found in abbiteye blueberry. Delphinidin-3-O-galactoside chloride show inhibitory activitiesagainst α-glucosidase with an IC₅₀ of 68.33 μM, and tyrosinase with an IC₅₀ of 34.14 μM. Delphinidin-3-O-galactoside chloride attenuates HO-1 and HSP70 messenger RNA down-regulation, suppresses cytotoxicity, reduces endoplasmic reticulum stress responses, scavenges free radicals, reduces intracellular triglyceride levels and lipid droplet accumulation. Delphinidin-3-O-galactoside chloride can be used for the researches of diabesity, melanoma and inflammation .

HY-N19830

Guavenoic acid	Triterpenes Structural Classification Terpenoids Psidium guajava Linn. Myrtaceae Plants Source Classification	Reactive Oxygen Species (ROS) Apoptosis
Guavenoic acid is a triterpenoid compound that can be isolated from fresh leaves of Psidium guajava. Guavenoic acid protects cells in cellular oxidative damage models, inhibits intracellular ROS production, and suppresses cell apoptosis. Guavenoic acid significantly enhances cellular proliferation, promotes insulin synthesis and secretion, and upregulates the messenger RNA expression of insulin gene, PDX-1 and MafA. Guavenoic acid can be used in the research of diseases such as pancreatic islet β-cell tumors .

Cat. No.	Product Name	Chemical Structure

HY-108496S

Sphingosine-1-phosphate-d7

Sphingosine-1-phosphate-d₇ is the deuterium labeled Sphingosine-1-phosphate. Sphingosine-1-phosphate (S1P) is an agonist of S1P1-5 receptors and a ligand of GPR3, GPR6 and GPR12.?Sphingosine-1-phosphate is an intracellular second messenger and mobilizes Ca2+ as an extracellular ligand for G protein-coupled receptors . Sphingosine-1-phosphate is an important lipid mediator generated from Sphingomyelin (HY-113498) or other membrane phospholipids .

HY-N0086S

N6-Methyladenosine-d3
N6-Methyladenosine-d₃ (6-Methyladenosine-d₃; N-Methyladenosine-d₃) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-N0086S2

N6-Methyladenosine-13C4
N6-Methyladenosine- ¹³C₄ (6-Methyladenosine- ¹³C₄; N-Methyladenosine- ¹³C₄) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.

HY-W767865

Cyclic GMP sodium-13C5

Cyclic GMP sodium- ¹³C₅ is the ¹³C-labeled Cyclic GMP sodium (HY-113469A). Cyclic GMP (cGMP) sodium, an important second messenger, is a major intracellular mediator of extracellular signals such as nitric oxide (NO) and natriuretic peptides (NPs). Effects of Cyclic GMP sodium occur through three main groups of cellular targets: cGMP-dependent protein kinases (PKGs), cGMP-gated cation channels, and PDEs. Cyclic GMP can inhibit both platelet adhesion and aggregation. cGAMP (Cyclic-GMP-AMP) (HY-12512), a conjugate of Cyclic GMP and AMP, can induce IRF3 phosphorylation and nuclear translocation, enhancing antiviral immune responses .

HY-N7063S1

Nerol-d6
Nerol-d₆ is deuterated labeled Nerol (HY-N7063). Nerol is a constituent of neroli oil. Nerol Nerol triggers mitochondrial dysfunction and induces apoptosis via elevation of Ca2+ and ROS. Antifungal activity .

HY-N0086S3

N6-Methyladenosine-13C3
N6-Methyladenosine- ¹³C₃ (6-Methyladenosine- ¹³C₃) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .

HY-W654000

Cyclic GMP-13C,15N2

Cyclic GMP- ¹³C, ¹⁵N₂ is ¹³C and ¹⁵N labeled Cyclic GMP (HY-113469). Cyclic GMP (cGMP), an important second messenger, is a major intracellular mediator of extracellular signals such as nitric oxide (NO) and natriuretic peptides (NPs). Effects of Cyclic GMP occur through three main groups of cellular targets: cGMP-dependent protein kinases (PKGs), cGMP-gated cation channels, and PDEs. Cyclic GMP can inhibit both platelet adhesion and aggregation. cGAMP (Cyclic-GMP-AMP) (HY-12512), a conjugate of Cyclic GMP and AMP, can induce IRF3 phosphorylation and nuclear translocation, enhancing antiviral immune responses .

HY-110382S

Cyclic-di-GMP-13C20,15N10 disodium

¹³C20, ¹⁵N10-Cyclic di-GMP ( ¹³C20, ¹⁵N10-c-di-GMP) is ¹³C and ¹⁵N labeled Cyclic-di-GMP (disodium). Cyclic-di-GMP disodium is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP disodium has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP disodium can be used in cancer research .

Cat. No.	Product Name		Classification

HY-112980

Nusinersen 4 Publications Verification		Antisense Oligonucleotides
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .

HY-132609

Patisiran sodium 1 Publications Verification		siRNAs siRNA drugs
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the *transthyretin (TTR) messenger* RNA**. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .

HY-112980A

Nusinersen sodium 4 Publications Verification		Antisense Oligonucleotides
Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .

HY-151507

306Oi10 1 Publications Verification		Cationic Lipids
306Oi10 is a branched ionizable lipid that can be used to construct lipid nanoparticles (LNPs) for delivering messenger RNA. The surface ionization of lipid nanoparticles is related to the effectiveness of mRNA delivery. The tail of 306Oi10 has a one-carbon branch, which provides it with stronger surface ionization compared to lipids with linear tails, thereby enhancing its mRNA delivery efficacy. 306Oi10 can be used in research related to mRNA delivery .

HY-132610A

Givosiran sodium 1 Publications Verification ALN-AS1 sodium		siRNAs siRNA drugs
Givosiran (ALN-AS1) sodium is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran sodium downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid (ALA) and porphobilinogen (PBG) levels. Givosiran sodium demonstrates potent inhibitory activity against ALAS1 in mouse, rat, and cynomolgus monkey models. Givosiran sodium can be used for the research of acute hepatic porphyria (AHP) .

HY-132610

Givosiran 1 Publications Verification ALN-AS1		siRNAs siRNA drugs
Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid (ALA) and porphobilinogen (PBG) levels. Givosiran demonstrates potent inhibitory activity against ALAS1 in mouse, rat, and cynomolgus monkey models. Givosiran can be used for the research of acute hepatic porphyria (AHP) .

HY-132587

Fitusiran ALN-AT3SC; SAR439774		siRNAs siRNA drugs
Fitusiran (ALN-AT3SC) is a siRNA strategy. Fitusiran delivers siRNA targeting the SERPINC1 gene in hepatocytes to inhibit antithrombin synthesis. Fitusiran enhances thrombin activity and increases Thrombin generation, thereby restoring hemostatic function. Fitusiran can be used in hemophilia-related research .

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium		Antisense Oligonucleotides
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-128468

1,2-Dimyristoyl-sn-glycerol		Phospholipids
1,2-Dimyristoyl-sn-glycerol is a saturated diacylglycerol and a weak second messenger for the activation of PKC .

HY-153492A

Olpasiran sodium AMG 890 sodium; ARC-LPA sodium		siRNAs siRNA drugs
Olpasiran (AMG 890, ARC-LPA) sodium is an N-acetyl galactosamine (GalNAc)-conjugated, hepatocyte-targeted siRNA. Olpasiran sodium directly inhibits LPA messenger RNA translation in hepatocytes and potently reduce Lp(a) concentration. Olpasiran sodium can be used for the research of cardiovascular disease, such as atherosclerosis .

HY-132587A

Fitusiran sodium ALN-AT3SC sodium; SAR439774 sodium		siRNAs siRNA drugs
Fitusiran (ALN-AT3SC) sodium is a siRNA strategy. Fitusiran delivers siRNA targeting the SERPINC1 gene in hepatocytes to inhibit antithrombin synthesis. Fitusiran sodium enhances thrombin activity and increases Thrombin generation, thereby restoring hemostatic function. Fitusiran sodium can be used in hemophilia-related research .

HY-150224

GalNAc unconjugated/naked Fitusiran sodium		siRNAs siRNA drugs
GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets *antithrombin (AT) messenger* RNA** to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .

HY-153609

AS-Patisiran sodium		siRNAs siRNA drugs
AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the *transthyretin (TTR) messenger* RNA**. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .

HY-174646

Human IL10 mRNA		mRNA Interleukin & Receptors
Human IL10 mRNA is the messenger ribonucleic acid that encodes human IL-10. The expression of IL-10 mRNA is highly inducible and cell type-specific.

HY-174728

Human CXCR1 mRNA		mRNA Chemokine & Receptors
Human CXCR1 mRNA encodes the human C-X-C motif chemokine receptor 1 (CXCR1) protein, a member of the G-protein-coupled receptor family. CXCR1 is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system.

HY-156985

Lipid AX4		Cationic Lipids
Lipid AX4 is an ionizable cationic lipid with the _pK_a of 6.89， and can be used the study for the formation of lipid nanoparticles (LNPs) for the delivery of mRNA in vivo .

HY-174792

Cre-T2A-GFP mRNA		mRNA Gene Editing
The Cre-T2A-GFP mRNA is a capped and polyadenylated messenger RNA encoding a Cre recombinase with a nuclear localization sequence (NLS) and a green fluorescent protein (GFP).

HY-174727

Human CXCR2 mRNA		mRNA Chemokine & Receptors
Human CXCR2 mRNA encodes the human C-X-C motif chemokine receptor 2 (CXCR2) protein, a member of the G-protein-coupled receptor family. CXCR2 is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth.

HY-174791

Cre-T2A-GFP mRNA (N1-Methylpseudo-UTP)		mRNA Gene Editing
The Cre-T2A-GFP mRNA is a capped and polyadenylated messenger RNA encoding a Cre recombinase with a nuclear localization sequence (NLS) and a green fluorescent protein (GFP). The incorporation of N1-Methylpseudo-UTP can reduce the immunogenicity of the resulting mRNA.

Targets Recommended: mRNA

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-B1511G

Cyclic AMP Cyclic adenosine monophosphate; Adenosine cyclic 3', 5'-monophosphate; cAMP	Endogenous Metabolite	Neurological Disease Metabolic Disease Cancer
Cyclic AMP (GMP) (Cyclic adenosine monophosphate (GMP)) is Cyclic AMP (HY-B1511) produced by using GMP guidelines. GMP small molecules works appropriately as an auxiliary reagent for cell therapy manufacture. Cyclic AMP (Cyclic adenosine monophosphate), adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP is an important second messenger in many biological processes .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

messenger

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Biochemical Assay Reagents

Peptides

NaturalProducts

Isotope-Labeled Compounds

Oligonucleotides

GMP Molecules

Natural
Products