Search Result

Results for "

viral RNA

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA/RNA Synthesis (64) Small Interfering RNA (siRNA) (2) Akt (1) Angiotensin-converting Enzyme (ACE) (1) Apoptosis (2) Arenavirus (2) Bacterial (5) Bcl-2 Family (1) Biochemical Assay Reagents (3) Caspase (1) CDK (1) CHIKV (4) Dengue Virus (9) DNA Methyltransferase (1) Drug Derivative (2) Drug Isomer (2) Drug Metabolite (7) Endogenous Metabolite (15) Endonuclease (1) Enterovirus (14) Filovirus (3) Flavivirus (10) Glycosyltransferase (1) HBV (12) HCV (22) HCV Protease (3) Histamine Receptor (2) Histone Acetyltransferase (3) HIV (11) HIV Integrase (1) HIV Protease (4) IFNAR (2) Influenza Virus (31) Isotope-Labeled Compounds (14) Lactate Dehydrogenase (2) Ligands for Target Protein for PROTAC (1) Liposome (1) Mitochondrial Metabolism (1) NOD-like Receptor (NLR) (3) Nucleoside Antimetabolite/Analog (7) Opioid Receptor (1) Orthopoxvirus (2) PROTACs (1) Reference Standards (7) Reverse Transcriptase (3) RIG-I-like receptor (RLR) (2) RSV (7) SARS-CoV (48) Sirtuin (2) Tomato Spotted Wilt Virus (TSWV) (1) Topoisomerase (4) TRP Channel (2) Virus Protease (6)
By Research Areas:	Cancer (17) Endocrinology (2) Infection (149) Inflammation/Immunology (9) Metabolic Disease (3) Neurological Disease (6)
Oligonucleotides:	Adenosine (1) Nucleoside Analogs (2) Aptamers (2) Nucleotide Analogs (3) Uridine (1) Cationic Lipids (1) siRNA drugs (1) Antisense Oligonucleotides (2) Adenine Nucleotide (1) siRNAs (1)

157

Inhibitors & Agonists

Screening Libraries

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

Natural
Products

Recombinant Proteins

Isotope-Labeled Compounds

Oligonucleotides

Targets Recommended: MicroRNA mRNA RNA MTase Small Interfering RNA (siRNA) DNA/RNA Synthesis Aminoacyl-tRNA Synthetase

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-14768

Favipiravir 45+ Cited Publications T-705	DNA/RNA Synthesis Influenza Virus SARS-CoV Bacterial	Infection
Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC₅₀ of 341 nM.

HY-104077

Remdesivir Maximum Cited Publications 214 Publications Verification GS-5734	DNA/RNA Synthesis SARS-CoV	Infection
Remdesivir (GS-5734) is a nucleoside analogue with effective antiviral activity. Remdesivir can inhibit the synthesis of viral DNA or RNA. Remdesivir can be used for the research of infection, such as SARS-CoV and MHV infection .

HY-109025A

Baloxavir 45+ Cited Publications Baloxavir acid; S-033447	Influenza Virus	Infection Cancer
Baloxavir (Baloxavir acid), derived from the proagent Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity .

HY-103586

GS-441524 25+ Cited Publications	DNA/RNA Synthesis SARS-CoV	Infection
GS-441524 is a potent, orally active and CNS-penetrant viral RNA-dependent RNA polymerase inhibitor. GS-441524 competes with natural nucleosides to block viral RNA transcription as an alternative substrate and RNA chain terminator. GS-441524 inhibits the replication of feline infectious peritonitis virus, African swine fever virus, and severe acute respiratory syndrome coronavirus 2. GS-441524 reduces viral RNA levels in cats. GS-441524 can be used in research related to feline infectious peritonitis, African swine fever, and coronavirus disease 2019 (COVID-19) .

HY-N0086

N6-Methyladenosine Maximum Cited Publications 7 Publications Verification 6-Methyladenosine; N-Methyladenosine	Influenza Virus Endogenous Metabolite	Infection
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-153810

Mosnodenvir JNJ-1802	Virus Protease Flavivirus Dengue Virus	Infection
Mosnodenvir (JNJ-1802) is an orally active pan serotype dengue virus (DENV) inhibitor, with EC₅₀ values ranging from 0.057 to 11 nM for four dengue virus (DENV) serotypes. Mosnodenvir blocks viral replication by inhibiting the formation of complexes between two viral proteins, nonstructural protein 3 (NS3) and NS4B, thereby preventing the formation of new viral RNA. Mosnodenvir exhibits picomolar to nanomolar antiviral activity in vitro and has antiviral efficacy in mice and non-human primates .

HY-126303C

GS-443902 trisodium 10+ Cited Publications GS-441524 triphosphate trisodium; Remdesivir metabolite trisodium	DNA/RNA Synthesis SARS-CoV RSV HCV Drug Metabolite	Infection
GS-443902 trisodium (GS-441524 triphosphate trisodium) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC₅₀s of 1.1 μM, 5 μM for RSV RdRp and HCV RdRp, respectively. GS-443902 trisodium is the active triphosphate metabolite of Remdesivir (GS-5734) .

HY-145586

Onradivir ZSP1273	Influenza Virus DNA/RNA Synthesis	Infection
Onradivir (ZSP1273) is an orally active antiviral agent targeting *influenza A virus RNA* polymerase PB2 subunit with an IC₅₀** of 0.562 nM. Onradivir inhibits cap binding to influenza A virus RNA polymerase PB2 subunit, suppresses viral replication, reduces viral titres and RNA loads, and inhibits influenza A virus infection. Onradivir maintains high survival rates in influenza A virus-infected mice, and reduces influenza A virus titers in a murine model. Onradivir can be used for the research of influenza A virus infection .

HY-18649

Galidesivir hydrochloride 10+ Cited Publications BCX4430 hydrochloride; Immucillin-A hydrochloride	DNA/RNA Synthesis SARS-CoV Filovirus	Infection
Galidesivir (BCX4430) hydrochloride, an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir hydrochloride is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir hydrochloride inhibits some negative-sense RNA viruses with EC₅₀s ranging from ~3 to ~68 μM .

HY-18649A

Galidesivir 10+ Cited Publications BCX4430; Immucillin-A	DNA/RNA Synthesis SARS-CoV Filovirus	Infection
Galidesivir (BCX4430), an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir inhibits some negative-sense RNA viruses with EC₅₀s ranging from ~3 to ~68 μM .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-30234A

Clemizole hydrochloride 1 Publications Verification	Histamine Receptor TRP Channel HCV Protease HCV	Inflammation/Immunology Endocrinology Cancer
Clemizole hydrochloride is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole hydrochloride is an inhibitor of TRPC5 channel. The IC₅₀ of Clemizole hydrochloride for RNA binding by NS4B is 24 nM, whereas its EC₅₀ for viral replication is 8 μM.

HY-W015764

T-1105 2 Publications Verification	Flavivirus	Infection
T-1105, a structural analogue of T-705, is a novel broad-spectrum viral polymerase inhibitor. T-1105 inhibits the polymerases of RNA viruses after being converted to ribonucleoside triphosphate (RTP) metabolite. T-1105 has antiviral activity against various RNA viruses. T-1105 can be formed by nicotinamide mononucleotide adenylyltransferase .

HY-155583

RNase L-IN-1	DNA/RNA Synthesis	Infection
RNase L-IN-1 (compound 17a) is an inhibitor of RNase L, or Ribonuclease L. RNase L degrades RNAs to prevent viral replication, and mediates the innate immune responses and inflammation .

HY-145994

Obeldesivir 1 Publications Verification ATV006	SARS-CoV	Infection
Obeldesivir (ATV006) is a potent, orally active antiviral agent and ester proagents of GS-441524. Obeldesivir inhibits the replication of SARS-CoV-2 and its variants. Obeldesivir can be used for SARS-CoV-2 research .

HY-14837

Amizon Enisamium iodide	Influenza Virus SARS-CoV	Infection
Amizon is an orally effective antiviral and anti-inflammatory agent. Amizon inhibits influenza virus replication and restricts viral RNA synthesis. Amizon reduces the mRNA expression of COX-1, COX-2, NF-κB, TGF1β, IL-1 and IL-6, and stimulates the secretion and mRNA expression of IL-10. Amizon inhibits the oxidative activity of macrophages and possesses antioxidant and free radical-scavenging activities. Amizon is applicable to research related to influenza and acute respiratory viral infections .

HY-122587

AVG-233	DNA/RNA Synthesis RSV	Infection
AVG-233 is a potent, orally active RNA dependent RNA polymerase (RdRp) inhibitor. AVG-233 prevents initiation of the viral polymerase complex at the promoter. AVG-233 binding site is present in the L_1-1749 fragment. AVG-233 has nanomolar activity against both RSV strains and clinical RSV isolates (EC₅₀=0.14-0.31 μM). AVG-233 can be used for research of respiratory syncytial virus (RSV) .

HY-137697D

ddCTP trisodium solution (100 mM)	HIV DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Drug Metabolite HIV Protease	Infection
ddCTP trilithium solution (100 mM) is a chain-terminating dideoxynucleotide. ddCTP trilithium is a type of chain-terminating deoxynucleotide. ddCTP trilithium can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP trilithium can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP trilithium is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .

HY-19743

Triazavirin 1 Publications Verification	Nucleoside Antimetabolite/Analog Influenza Virus DNA/RNA Synthesis	Infection
Triazavirin is a nucleoside analogue of nucleic acid and an antiviral agent. Triazavirin works by inhibiting the synthesis of viral RNA and DNA and replication of genomic fragments. Triazavirin is also an effective protective agent on the transmission stage of influenza .

HY-126303

GS-443902 GS-441524 triphosphate; Remdesivir metabolite	DNA/RNA Synthesis SARS-CoV RSV HCV Drug Metabolite	Infection
GS-443902 (GS-441524 triphosphate) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC₅₀s of 1.1 µM, 5 µM for RSV RdRp and HCV RdRp, respectively. GS-443902 is the active triphosphate metabolite of Remdesivir .

HY-N8533

Sodium Camptothecin	DNA/RNA Synthesis	Infection Cancer
Sodium Camptothecin is a plant alkaloid, with antitumor activity. Sodium Camptothecin is a reversible inhibitor of RNA synthesis. Sodium Camptothecin is an effective inhibitor of adenovirus replication. Sodium Camptothecin inhibits DNA synthesis and causes breaks in intracellular preformed viral DNA .

HY-W013403

2'-Deoxy-2'-fluorouridine	IFNAR	Infection
2'-Deoxy-2'-fluorouridine is a derivative of the pyrimidine nucleoside uridine. 2'-Deoxy-2'-fluorouridine is a nucleoside analog that inhibits the replication of wild-type viruses by binding to the viral RNA. Hepatitis C polyU/UC RNA strands containing 2'-Deoxy-2'-fluorouridine, bind to RIG-I but do not activate RIG-I signaling in a reporter assay using Huh7 cells. 2'-Deoxy-2'-fluorouridine also has been used as a starting material in the synthesis of respiratory syncytial virus (RSV) polymerase inhibitors. 2'-Deoxy-2'-fluorouridine can incorporate into DNA and RNA in rat and woodchuck model upon administration. 2'-Deoxy-2'-fluorouridine can be studied in anti-viral research .

HY-135867E

NHC-triphosphate tetraammonium 5+ Cited Publications	CHIKV Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV	Infection
NHC-triphosphate tetraammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate tetraammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-131603

Lamivudine triphosphate 3TCTP	Reverse Transcriptase HCV HBV SARS-CoV Drug Derivative	Infection
Lamivudine triphosphate (3TCTP) is a phosphorylated Lamivudine (HY-B0250) (a nucleoside analogue). Lamivudine triphosphate inhibits the reverse transcriptase of HIV or HBV viruses to block viral replication by chain termination. Lamivudine triphosphate is also an inhibitor of the RdRp activity of the NS5B subunit of the HCV. Lamivudine triphosphate can be incorporated into the nascent RNA by the SARS-CoV-2 RdRp, thus halting mutations in the nascent SARS-CoV-2 RNA .

HY-W250152

Polycytidylic acid potassium	Biochemical Assay Reagents	Inflammation/Immunology
Polycytidylic acid potassium is an immunostimulant and synthetic double-stranded RNA. Polycytidylic acid potassium can be used experimentally to model viral infections in vivo. Polycytidylic acid potassium is a common tool in immune system research .

HY-126113

KIN101	Flavivirus Dengue Virus RIG-I-like receptor (RLR) Influenza Virus HCV	Infection
KIN101 is a potent **RNA viral inhibitor with IC₅₀s of 2 μM, >5 μM for influenza virus and Dengue virus (DNV), respectively. KIN101, an isoflavone agonist of IRF-3** dependent signaling, induces IRF-3 nuclear translocation. KIN101 has broad-spectrum activity against RNA viruses .

HY-106312A

Enviroxime LY122772	Enterovirus	Infection
Enviroxime (LY122772) is an antiviral compound that inhibits the replication of rhinoviruses and enteroviruses. Enviroxime blocks the replication of plus-strand viral RNA by targeting the viral 3A coding region. Enviroxime can be a useful tool for investigating the natural function of the 3A protein .

HY-10118

Filibuvir 4 Publications Verification	HCV DNA/RNA Synthesis	Infection
Filibuvir is an orally active, selective non-nucleoside inhibitor of the *HCV nonstructural 5B protein (NS5B) RNA-dependent RNA* polymerase (RdRp)*. Filibuvir binds noncovalently in the thumb II allosteric pocket of NS5B. Filibuvir inhibits genotype 1a and 1b replicons with EC₅₀s of 59 nM for both isoforms, respectively . Filibuvir preferentially inhibits elongative RNA* synthesis and potently decreases viral RNA accumulation .

HY-30234

Clemizole 1 Publications Verification	Histamine Receptor TRP Channel HCV Protease HCV	Inflammation/Immunology Endocrinology Cancer
Clemizole is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole is an inhibitor of TRPC5 channel. The IC₅₀ of Clemizole for RNA binding by NS4B is 24±1 nM, whereas its EC₅₀ for viral replication is 8 µM.

HY-44358

Remdesivir nucleoside monophosphate 3 Publications Verification	Drug Metabolite DNA/RNA Synthesis SARS-CoV	Infection
Remdesivir nucleoside monophosphate is a metabolite of Remdesivir (HY-104077). Remdesivir is a nucleoside analogue with effective antiviral activity. Remdesivir can inhibit the synthesis of viral DNA or RNA. Remdesivir can be used for the research of infection, such as SARS-CoV and MHV infection .

HY-155386

Peroxynitrite sodium	Biochemical Assay Reagents Enterovirus DNA/RNA Synthesis Mitochondrial Metabolism	Infection Neurological Disease
Peroxynitrite sodium is a product of the diffusion-controlled reaction between nitric oxide and superoxide radicals, as well as an oxidant and an antiviral agent. Peroxynitrite sodium inhibits Mitochondrial respiration. Peroxynitrite sodium suppresses the replication of Coxsackievirus, partly by inhibiting viral *RNA* entry into host cells. Peroxynitrite sodium induces a significant nociceptive response .

HY-153228

Pomotrelvir 1 Publications Verification PBI-0451	SARS-CoV	Infection
Pomotrelvir is a selective, competitive, orally active covalent inhibitor of the SARS-CoV-2 main protease (M ^pro), with an IC₅₀ of 24 nM for wild-type SARS-CoV-2 M ^pro. Pomotrelvir inhibits viral polyprotein processing, thereby preventing viral replication. Pomotrelvir has shown broad antiviral activity against multiple SARS-CoV-2 variants (including Omicron) in cell-based experiments, and has an additive effect when combined with nucleoside analogs that target viral RNA synthesis. Pomotrelvir is primarily used for the research and development of COVID-19 antiviral drugs, especially for infections caused by SARS-CoV-2 and its variants .

HY-156215

NCI-B16	HCV	Infection
NCI-B16 is a small molecule RNA binder and inhibits HCV viral replication .

HY-103586A

GS-441524 hydrochloride 25+ Cited Publications	DNA/RNA Synthesis SARS-CoV	Infection
GS-441524 hydrochloride is a potent, orally active and CNS-penetrant viral RNA-dependent RNA polymerase inhibitor. GS-441524 hydrochloride competes with natural nucleosides to block viral RNA transcription as an alternative substrate and RNA chain terminator. GS-441524 hydrochloride inhibits the replication of feline infectious peritonitis virus, African swine fever virus, and severe acute respiratory syndrome coronavirus 2. GS-441524 hydrochloride reduces viral RNA levels in cats. GS-441524 hydrochloride can be used in research related to feline infectious peritonitis, African swine fever, and coronavirus disease 2019 (COVID-19) .

HY-137697

ddCTP	Nucleoside Antimetabolite/Analog DNA/RNA Synthesis HIV Protease HIV Drug Metabolite	Infection
ddCTP is a type of chain-terminating deoxynucleotide. ddCTP can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .

HY-W269306

Bonaphthone	DNA/RNA Synthesis Influenza Virus	Infection
Bonaphthone is an antiviral agent with anti-DNA and -RNA viral activities .

HY-172918

VV261	Influenza Virus Arenavirus	Infection
VV261 is an orally active prodrug of 4'-fluorouridine. VV261 inhibits viral RNA-dependent RNA polymerase. VV261 exhibits antiviral activity against CCHFV, SFTSV and LCMV. VV261 can be used in research related to viral infections .

HY-W128400

3′-Deoxy-3′-fluoroguanosine	DNA/RNA Synthesis HCV	Infection
3′-Deoxy-3′-fluoroguanosine exhibits antiviral activity against tick-borne encephalitis virus (TBEV), through interaction with NS5B RdRp of HCV, resulting in suppression of viral RNA synthesis by disruption of further extension of the replicating viral RNA .

HY-155583A

RNase L-IN-1 trihydrochloride	DNA/RNA Synthesis	Infection
RNase L-IN-1 (compound 17a) trihydrochloride is an inhibitor of RNase L or ribonuclease L. RNase L degrades RNA to prevent viral replication and mediates innate immune responses and inflammation .

HY-159067

DEAE-dextran, MW 500000 hydrochloride DEAE-dextran, MW 500000 hydrochloride, from bacterial (Leuconostoc mesenteroides); Diethylaminoethyl-dextran, MW 500000 hydrochloride	Biochemical Assay Reagents	Cancer
DEAE-dextran, MW 500000 hydrochloride (DEAE-dextran, MW 500000 hydrochloride, from bacterial (Leuconostoc mesenteroides)) is a high-molecular-weight positively charged polymer that significantly enhances the uptake of viral RNA by tissue culture cells. When employed in the delivery system for "tumor immunity" RNA-splenocyte transfer, DEAE-dextran can markedly extend the lifespan of tumor-bearing animals, comparable to that of actively immunized animals. Furthermore, DEAE-dextran serves as a complexing agent for nucleic acids, forming composite particles with DNA/RNA for extensive applications in gene delivery. Additionally, DEAE-dextran can be utilized as a coating for liposomes .

HY-111233

Disoxaril WIN-51711	Enterovirus	Infection
Disoxaril (WIN-51711) is an antivirus agent with activity against poliovirus types 1 and 2. Disoxaril inserts into the hydrophobic interior of virus capsid protein VP1 to stabilize virion conformation, inhibits poliovirus uncoating, and prevents viral RNA release and synthesis. Disoxaril can be used for the research of poliovirus infection .

HY-177817

CL9 sodium	RIG-I-like receptor (RLR)	Infection
CL9 sodium, a RIG-I-specific RNA aptamer, activates signaling pathways for IFNβ produciton and efficiently blocks viral replication. RIG-I is a cytosolic receptor for non-self RNA that mediates immune responses against viral infections through IFNα/β prod

HY-W555382

Pseudane IX 2-Nonylquinolin-4(1H)-one	HCV	Infection
Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC₅₀ value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .

HY-104077R

Remdesivir (Standard) GS-5734 (Standard)	Reference Standards DNA/RNA Synthesis SARS-CoV	Infection
Remdesivir (Standard) (GS-5734 (Standard)) is a nucleoside analogue with effective antiviral activity. Remdesivir (Standard) can inhibit the synthesis of viral DNA or RNA. Remdesivir (Standard) can be used for the research of infection, such as SARS-CoV and MHV infection .

HY-19643

JTK-109	HCV Protease	Infection
JTK-109 is a potent inhibitor of hepatitis C virus NS5B RNA-dependent RNA polymerase. JTK-109 has NS5B inhibitory activity with IC₅₀ value of 0.017μM. JTK-109 can be used for the research of hepatitis C virus (HCV) .

HY-135867

NHC-triphosphate	CHIKV Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV	Infection
NHC-triphosphate is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-148781

HBV-IN-30	HBV	Infection
HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .

HY-148167

2'-Deoxy-2'-fluoro-l-uridine	DNA/RNA Synthesis Virus Protease	Infection
2'-Deoxy-2'-fluoro-l-uridine is an L-nucleoside compound. 2'-Deoxy-2'-fluoro-l-uridine is a potent, selective viral RNA polymerase inhibitor, thereby inhibiting RNA virus replication .

HY-162793

RdRP-IN-8	DNA/RNA Synthesis Influenza Virus	Infection
RdRP-IN-8 (compound 45) is an anti-influenza virus compound. RdRP-IN-8 inhibits viral RNA-dependent RNA polymerase (RdRP) activity by disrupting heterodimerization of PA and PB1 subunits (EC₅₀=0.13 μM) .

Cat. No.	Product Name

HY-L044

Nucleotide Compound Library

572 compounds

Nucleoside and nucleotide analogues are synthetic, chemically modified compounds that have been developed to mimic their physiological counterparts in order to exploit cellular metabolism and subsequently be incorporated into DNA and RNA to inhibit cellular division and viral replication. In addition to their incorporation into nucleic acids, nucleoside and nucleotide analogues can interact with and inhibit essential enzymes such as human and viral polymerases (that is, DNA-dependent DNA polymerases, RNA-dependent DNA polymerases or RNA-dependent RNA polymerases), kinases, ribonucleotide reductase, DNA methyltransferases, purine and pyrimidine nucleoside phosphorylase and thymidylate synthase. These actions of nucleoside and nucleotide analogues have potential therapeutic benefits — for example, in the inhibition of cancer cell growth, the inhibition of viral replication as well as other indications.

MCE offers a unique collection of 572 nucleotide compounds including nucleotide, nucleoside and their structural analogues. MCE Nucleotide Compound Library is a useful tool to discover anti-cancer and antiviral drugs for high throughput screening (HTS) and high content screening (HCS).

HY-L073

Anti-Hepatitis C Virus Compound Library

391 compounds

Hepatitis C virus (HCV) is a hepatotropic enveloped positive- strand RNA virus (family Flaviviridae) that infects the parenchymal cells of the liver. HCV infection is a significant public health burden. Globally, an estimated 71 million people have chronic hepatitis C virus infection. A significant number of those who are chronically infected will develop cirrhosis or liver cancer. To date, there is no vaccine against HCV, and combination pegylated alpha interferon (pIFN-) and ribavirin, the main standard-of-care treatment for HCV, is effective in only a subset of patients and is associated with a wide spectrum of toxic side effects and complications. More recently, new therapeutic approaches that target essential components of the HCV life cycle have been developed, including direct-acting antiviral (DAA) that specifically block a viral enzyme or functional protein and host-targeted agents (HTA) that block interactions between host proteins and viral components that are essential to the viral life cycle. However, the genetic diversity of HCV viruses and the stage of liver disease (i.e., cirrhosis) are revealing themselves as obstacles for effective, pan-genotypic treatments. There still exists a need for the discovery and development of new HCV inhibitors. In particular, since the future of HCV therapy will likely consist of a cocktail approach using multiple inhibitors that target different steps of infection, new antivirals targeting all steps of the viral infection cycle.

MCE offers a unique collection of 391 compounds with identified and potential anti-HCV activity. MCE Anti- Hepatitis C Virus Compound Library is a useful tool for discovery new anti-HCV drugs and other anti-infection research.

Cat. No.	Product Name	Type

HY-W250152

Polycytidylic acid potassium	Biochemical Assay Reagents
Polycytidylic acid potassium is an immunostimulant and synthetic double-stranded RNA. Polycytidylic acid potassium can be used experimentally to model viral infections in vivo. Polycytidylic acid potassium is a common tool in immune system research .

HY-137697

ddCTP

Biochemical Assay Reagents

ddCTP is a type of chain-terminating deoxynucleotide. ddCTP can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .

HY-159067

DEAE-dextran, MW 500000 hydrochloride

DEAE-dextran, MW 500000 hydrochloride, from bacterial (Leuconostoc mesenteroides); Diethylaminoethyl-dextran, MW 500000 hydrochloride

Biochemical Assay Reagents

DEAE-dextran, MW 500000 hydrochloride (DEAE-dextran, MW 500000 hydrochloride, from bacterial (Leuconostoc mesenteroides)) is a high-molecular-weight positively charged polymer that significantly enhances the uptake of viral RNA by tissue culture cells. When employed in the delivery system for "tumor immunity" RNA-splenocyte transfer, DEAE-dextran can markedly extend the lifespan of tumor-bearing animals, comparable to that of actively immunized animals. Furthermore, DEAE-dextran serves as a complexing agent for nucleic acids, forming composite particles with DNA/RNA for extensive applications in gene delivery. Additionally, DEAE-dextran can be utilized as a coating for liposomes .

Cat. No.	Product Name	Target	Research Area

HY-P10974

La peptide	HCV Enterovirus	Infection
La peptide (LAP) is an internal ribosome entry site (IRES) inhibitor. La peptide efficiently enters cells, blocks binding of cellular transacting factors to viral IRES, followed by inhibiting IRES-mediated translation. La peptide can be used for RNA viruses research, such as hepatitis C (HCV) and poliovirus (PV) .

HY-P10836

DN59	Dengue Virus	Infection
DN59 is a 33 amino acid peptide that mimics the dengue virus type 2 E stem region. DN59 inhibits all four serotypes of dengue virus (IC₅₀: 2-5 μM) as well as other flaviviruses. N59 causes the release of genomic RNA by interacting directly with viral particles. DN59 has antiviral activity .

Cat. No.	Product Name	Target	Research Area	Image

HY-P992155

Arevirumab Arevirumab-3	Arenavirus	Infection
Arevirumab (Arevirumab-3) is a pan-lineage neutralizing human monoclonal antibody cocktail (8.9F, 12.1F, 37.D). Arevirumab protects cynomolgus monkeys from severe Lassa fever caused by lineage II and III LASV isolates. Arevirumab is applicable to research related to Lassa fever .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-N0086

N6-Methyladenosine Maximum Cited Publications 7 Publications Verification 6-Methyladenosine; N-Methyladenosine	Infection Natural Products Microorganisms Classification of Application Fields Endogenous metabolite Disease Research Fields Source Classification	Influenza Virus Endogenous Metabolite
N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-W019670

N4-Acetylcytidine 1 Publications Verification	Natural Products Classification of Application Fields Metabolic Disease Endogenous metabolite Disease Research Fields Source Classification	Endogenous Metabolite Histone Acetyltransferase Enterovirus NOD-like Receptor (NLR)
N4-acetylcytidine (N4A) is an endogenous nucleoside metabolite from the degradation of tRNA. N4-Acetylcytidine is formed by N-acetyltransferase 10 and other enzymes. N4-acetylcytidine might sustain NLRP3 inflammasome activation via induction of HMGB1 expression and releasee. N4-Acetylcytidine modifies mRNA, tRNA and rRNA, affecting their stability, translation efficiency (such as enterovirus 71 RNA). N4-Acetylcytidine is used in the study of cancer, neuroinflammatory diseases, viral infections and obesity .

HY-N8533

Sodium Camptothecin	Infection Alkaloids Pyrrole Alkaloids Classification of Application Fields Quinoline Alkaloids Camptotheca acuminata Decne. Plants Nyssaceae Disease Research Fields Source Classification	DNA/RNA Synthesis
Sodium Camptothecin is a plant alkaloid, with antitumor activity. Sodium Camptothecin is a reversible inhibitor of RNA synthesis. Sodium Camptothecin is an effective inhibitor of adenovirus replication. Sodium Camptothecin inhibits DNA synthesis and causes breaks in intracellular preformed viral DNA .

HY-N0086R

N6-Methyladenosine (Standard) 1 Publications Verification 6-Methyladenosine (Standard); N-Methyladenosine (Standard)	Structural Classification Natural Products Microorganisms Endogenous metabolite Source Classification	Endogenous Metabolite Influenza Virus Reference Standards
N6-Methyladenosine (Standard) is the analytical standard of N6-Methyladenosine. This product is intended for research and analytical applications. N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs and has antiviral activities. In Vitro:** N6-methyladenosine (m6A) is selectively recognized by the human YTH domain family 2 (YTHDF2) protein to regulate mRNA degradation. N6-methyladenosine (m6A), a prevalent internal modification in the messenger RNA of all eukaryotes, is post-transcriptionally installed by m6A methyltransferase (e.g., MT-A70) within the consensus sequence of G(m6A)C (70%) or A(m6A)C (30%). N6-methyladenosine (m6A)-containing RNAs are greatly enriched in the YTHDF-bound portion and diminished in the flow-through portion . N6-methyladenosine (m6A), the most abundant internal RNA modification, functions in diverse biological processes, including regulation of embryonic stem cell self-renewal and differentiation. N6-methyladenosine (m6A) is a large protein complex, consisting in part of methyltransferase-like 3 (METTL3) and methyltransferase-like 14 (METTL14) catalytic subunits .

HY-W019670R

N4-Acetylcytidine (Standard)	Structural Classification Natural Products Endogenous metabolite Source Classification	Reference Standards Endogenous Metabolite Histone Acetyltransferase Enterovirus NOD-like Receptor (NLR)
N4-acetylcytidine (N4A) is an endogenous nucleoside metabolite from the degradation of tRNA. N4-Acetylcytidine is formed by N-acetyltransferase 10 and other enzymes. N4-acetylcytidine might sustain NLRP3 inflammasome activation via induction of HMGB1 expression and releasee. N4-Acetylcytidine modifies mRNA, tRNA and rRNA, affecting their stability, translation efficiency (such as enterovirus 71 RNA). N4-Acetylcytidine is used in the study of cancer, neuroinflammatory diseases, viral infections and obesity .

HY-W555382

Pseudane IX 2-Nonylquinolin-4(1H)-one	Alkaloids Ketones, Aldehydes, Acids Ruta graveolens Linn. Rutaceae Quinoline Alkaloids Plants Source Classification	HCV
Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC₅₀ value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .

HY-135867

NHC-triphosphate	Infection Natural Products Classification of Application Fields Endogenous metabolite Disease Research Fields Source Classification	CHIKV Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV
NHC-triphosphate is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-135867A

NHC-triphosphate tetrasodium	Natural Products Classification of Application Fields Other Diseases Endogenous metabolite Disease Research Fields Source Classification	CHIKV Endogenous Metabolite Enterovirus HCV Topoisomerase
NHC-triphosphate tetrasodium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate tetrasodium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-135867F

NHC-diphosphate triammonium 1 Publications Verification	Infection Natural Products Classification of Application Fields Endogenous metabolite Disease Research Fields Source Classification	CHIKV Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV
NHC-diphosphate triammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a diphosphate form . NHC-diphosphate triammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .

HY-N17251

Cusculine FAC21	Structural Classification Alkaloids Rutaceae Acridone Alkaloids Plants Angostura paniculata Source Classification	Endonuclease
Cusculine (FAC21) is an oropouche virus (OROV) endonuclease inhibitor with an IC₅₀ of 1.4 μM. Cusculine strongly interacts with OROV endonuclease, possibly limiting viral RNA interaction with other proteins, intercalates into double-stranded RNA (a viral replication intermediate), and efficiently inhibits *OROV viral* replication** in vitro. Cusculine can be used for the research of oropouche fever .

HY-N16775

Gylongiposide I	Triterpenes Structural Classification Terpenoids Cucurbitaceae Plants Gynostemma pentaphyllum (Thunb.) Makino Source Classification	Enterovirus
Gylongiposide I is a selective inhibitor against the enterovirus EV71 with an EC₅₀ of 1.53 μM. Gylongiposide I exerts antiviral activity by reducing viral protein VP1 expression and viral genomic RNA levels. Gylongiposide I can be used in the development of anti-EV71 drugs related to hand, foot and mouth disease .

Species:	Virus (3)
Tag:	His (1) Tag Free (3) Flag (1)
Source:	Sf9 insect cells (1) E. coli (3)

Cat. No.	Compare	Product Name	Species	Source	Image

HY-P703547

	HCVNS5B Protein, HCV Genome polyprotein; Hepatitis C virus genotype 1b (strain HC-J4); HCV; p23; Helicase; Hydrolase; Ion channel; Multifunctional enzyme; Nucleotidyltransferase; Protease; Ribonucleoprotein; RNA-binding; RNA-directed RNA polymerase; Serine protease; Thiol protease; Transferase; viral ion channel; viral nucleoprotein	Others	E. coli
	POLG proteins play multiple roles in the viral life cycle, contributing to viral RNA packaging, budding, and particle production. It exhibits RNA-binding and RNA chaperone activities, affecting translation initiation through interactions with viral IRES and ribosomal subunits. HCVNS5B Protein, HCV is the recombinant HCVNS5B, expressed by E. coli, with tag-free.

HY-P703529

	SARS-CoV-2 NCP N Protein (101a.a) Nucleoprotein; Nucleocapsid protein; NC; Protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; viral nucleoprotein	Virus	E. coli
	The SARS-CoV-2 nucleocapsid protein plays a crucial role in assembling the virion, forming the helical ribonucleocapsid (RNP), and interacting with the viral genome and membrane protein M. In addition to its structural function, it also enhances subgenomic viral RNA transcription and overall replication. NCP N Protein, SARS-CoV-2 (N269-K369) is the recombinant virus-derived NCP N, expressed by E. coli, with tag-free.

HY-P703530

	SARS-CoV-2 NCP N Protein (126a.a) Nucleoprotein; Nucleocapsid protein; NC; Protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; viral nucleoprotein	Virus	E. coli
	The SARS-CoV-2 nucleocapsid protein plays a crucial role in assembling the virion, forming the helical ribonucleocapsid (RNP), and interacting with the viral genome and membrane protein M. In addition to its structural function, it also enhances subgenomic viral RNA transcription and overall replication. NCP N Protein, SARS-CoV-2 (N48-A173) is the recombinant virus-derived NCP N, expressed by E. coli, with tag-free.

HY-P703531

	SARS-CoV-2 NCP N Protein (sf9, His, Flag) Nucleoprotein; Nucleocapsid protein; NC; Protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; viral nucleoprotein	Virus	Sf9 insect cells
	The SARS-CoV-2 nucleocapsid protein plays a crucial role in assembling the virion, forming the helical ribonucleocapsid (RNP), and interacting with the viral genome and membrane protein M. In addition to its structural function, it also enhances subgenomic viral RNA transcription and overall replication. NCP N Protein, SARS-CoV-2 (Sf9, His, Flag) is the recombinant virus-derived NCP N, expressed by Sf9 insect cells, with His, Flag labeled tag.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name	Chemical Structure

HY-104077S1

Remdesivir-d4
Remdesivir-d₄ (GS-5734-d₄) is deuterium labeled Remdesivir (HY-104077). Remdesivir (GS-5734) is a nucleoside analogue with effective antiviral activity. Remdesivir can inhibit the synthesis of viral DNA or RNA. Remdesivir can be used for the research of infection, such as SARS-CoV and MHV infection .

HY-N0086S

N6-Methyladenosine-d3
N6-Methyladenosine-d₃ (6-Methyladenosine-d₃; N-Methyladenosine-d₃) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-W753593

N4-Acetylcytidine-13C5

N4-Acetylcytidine- ¹³C₅ is the ¹³C-labeled N4-Acetylcytidine (HY-W019670). N4-acetylcytidine (N4A) is an endogenous nucleoside metabolite from the degradation of tRNA. N4-Acetylcytidine is formed by N-acetyltransferase 10 and other enzymes. N4-acetylcytidine might sustain NLRP3 inflammasome activation via induction of HMGB1 expression and releasee. N4-Acetylcytidine modifies mRNA, tRNA and rRNA, affecting their stability, translation efficiency (such as enterovirus 71 RNA). N4-Acetylcytidine is used in the study of cancer, neuroinflammatory diseases, viral infections and obesity .

HY-N0086S2

N6-Methyladenosine-13C4
N6-Methyladenosine- ¹³C₄ (6-Methyladenosine- ¹³C₄; N-Methyladenosine- ¹³C₄) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies **viral RNAs** and has antiviral activities.

HY-104077S

Remdesivir-d5 2 Publications Verification
Remdesivir-d₅ (GS-5734-d₅) is a deuterium labeled Remdesivir (HY-104077). Remdesivir (GS-5734) is a nucleoside analogue with effective antiviral activity. Remdesivir can inhibit the synthesis of viral DNA or RNA. Remdesivir can be used for the research of infection, such as SARS-CoV and MHV infection .

HY-B0402S

Amantadine-d15
Amantadine-d₁₅ is the deuterium labeled Amantadine. Amantadine (1-Adamantanamine) is an antiviral agent with activity against influenza A viruses. Amantadine blocks the proton flow through the M2 ion channel (M2 proton channel of influenza A) and thus prevents the release of viral RNA into the cytoplasm of the infected cells. Amantadine is an antiparkinsonian agent .

HY-109025AS

Baloxavir-d5
Baloxavir-d₅ is deuterium labeled Baloxavir. Baloxavir (Baloxavir acid), derived from the proagent Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity .

HY-14768S

Favipiravir-13C15N

Favipiravir- ¹³C ¹⁵N (T-705- ¹³C ¹⁵N) is ¹³C and ¹⁵N labeled Favipiravir. Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC₅₀ of 341 nM.

HY-W751835

Baloxavir-d4

Baloxavir-d₄ (Baloxavir acid-d₄; S-033447-d₄) is the deuterium-labeled Baloxavir (HY-109025A). Baloxavir-d₄ (Baloxavir-d₄ acid), derived from the proagent Baloxavir-d₄ marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir-d₄ inhibits viral RNA transcription and replication and has potently antiviral activity .

HY-W769714

Favipiravir-13C3
Favipiravir- ¹³C3 is the ¹³C labeled isotope of Favipiravir (HY-14768). Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC₅₀ of 341 nM.

HY-104077S2

Remdesivir impurity 9-d4
Remdesivir impurity 9-d₄ is deuterium labeled Remdesivir (HY-104077). Remdesivir (GS-5734) is a nucleoside analogue with effective antiviral activity. Remdesivir can inhibit the synthesis of viral DNA or RNA. Remdesivir can be used for the research of infection, such as SARS-CoV and MHV infection .

HY-N0086S3

N6-Methyladenosine-13C3
N6-Methyladenosine- ¹³C₃ (6-Methyladenosine- ¹³C₃) is ¹³C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .

HY-W013403S

2'-Deoxy-2'-fluorouridine-d2

2'-Deoxy-2'-fluorouridine-d₂ is the deuterium labeled 2'-Deoxy-2'-fluorouridine . 2'-Deoxy-2'-fluorouridine is a derivative of the pyrimidine nucleoside uridine. 2'-Deoxy-2'-fluorouridine is a nucleoside analog that inhibits the replication of wild-type viruses by binding to the viral RNA. Hepatitis C polyU/UC RNA strands containing 2'-Deoxy-2'-fluorouridine, bind to RIG-I but do not activate RIG-I signaling in a reporter assay using Huh7 cells. 2'-Deoxy-2'-fluorouridine also has been used as a starting material in the synthesis of respiratory syncytial virus (RSV) polymerase inhibitors. 2'-Deoxy-2'-fluorouridine can incorporate into DNA and RNA in rat and woodchuck model upon administration. 2'-Deoxy-2'-fluorouridine can be studied in anti-viral research .

HY-W555382S

Pseudane IX-d4
Pseudane IX-d₄ (2-Nonylquinolin-4(1H)-one-d₄) is deuterium labeled Pseudane IX. Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC₅₀ value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .

HY-103586S2

GS-441524-d

GS-441524-d is the deuterium labeled GS-441524 (HY-103586). GS-441524 is a potent, orally active and CNS-penetrant viral RNA-dependent RNA polymerase inhibitor. GS-441524 competes with natural nucleosides to block viral RNA transcription as an alternative substrate and RNA chain terminator. GS-441524 inhibits the replication of feline infectious peritonitis virus, African swine fever virus, and severe acute respiratory syndrome coronavirus 2. GS-441524 reduces viral RNA levels in cats. GS-441524 can be used in research related to feline infectious peritonitis, African swine fever, and coronavirus disease 2019 (COVID-19) .

HY-109025AS2

Baloxavir-d1
Baloxavir-d₁ is the deuterium labeled Baloxavir (HY-109025A). Baloxavir (Baloxavir acid), derived from the proagent Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity .

Cat. No.	Product Name		Classification

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium		Antisense Oligonucleotides
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-W039442

2′-Deoxy-2′-fluoroadenosine 1 Publications Verification		Nucleoside Analogs Adenosine
2′-Deoxy-2′-fluoroadenosine is a fluorinated deoxyadenosine with antitumor and antiviral activity, able to interfere with viral or cancer cell replication by being incorporated into DNA. 2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP .

HY-173189A

2-5A pentasodium solution (100 mM) 2′,5′-ApApA pentasodium; 2′,5′-trioligoadenylate pentasodium; 5'-O-Triphosphoryladenylyl-(2'→5')-adenylyl-(2'→5')-adenosine pentasodium		Nucleotide Analogs Adenine Nucleotide
2-5A (2′,5′-ApApA) pentasodium solution 100 mM is a high-affinity (K_a=0.04 nM) RNase L binder. 2-5A pentasodium solution 100 mM activates the nuclease activity of latent RNase L to cleave single-stranded RNA by inducing conformational changes and dimerization of latent RNase L, thereby mediating critical antiviral responses and enhancing interferon effects. 2-5A pentasodium solution 100 mM not only effectively inhibits Rauscher murine leukemia virus replication, reduces viremia and splenomegaly, but also enhances antileukemic efficacy when combined with amphotericin B and exhibits favorable high-dose tolerance. 2-5A pentasodium solution 100 mM is an important tool molecule for investigating the pathological mechanisms of viral infection, hereditary prostate cancer and leukemia .

HY-137697D

ddCTP trisodium solution (100 mM)		Nucleotide Analogs
ddCTP trilithium solution (100 mM) is a chain-terminating dideoxynucleotide. ddCTP trilithium is a type of chain-terminating deoxynucleotide. ddCTP trilithium can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP trilithium can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP trilithium is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .

HY-147266

Elebsiran sodium VIR-2218 sodium		siRNAs siRNA drugs
Elebsiran (VIR-2218) sodium is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran sodium leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran sodium binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran sodium can be used for the study of chronic HBV/HDV infections .

HY-137697

ddCTP		Nucleotide Analogs
ddCTP is a type of chain-terminating deoxynucleotide. ddCTP can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .

HY-177817

CL9 sodium		Aptamers
CL9 sodium, a RIG-I-specific RNA aptamer, activates signaling pathways for IFNβ produciton and efficiently blocks viral replication. RIG-I is a cytosolic receptor for non-self RNA that mediates immune responses against viral infections through IFNα/β prod

HY-148167

2'-Deoxy-2'-fluoro-l-uridine		Nucleoside Analogs Uridine
2'-Deoxy-2'-fluoro-l-uridine is an L-nucleoside compound. 2'-Deoxy-2'-fluoro-l-uridine is a potent, selective viral RNA polymerase inhibitor, thereby inhibiting RNA virus replication .

HY-177813

148.1-38m sodium		Aptamers
148.1-38m sodium, an RNA aptamer, inhibits HIV-1 reverse transcriptase (RT) and interfere with viral replication.

HY-171984

514O6,10		Cationic Lipids
514O6,10 is an ionizable lipidoid containing a branched-tail. 514O6,10 can be used to synthesize lipid nanoparticles (LNPs) for delivering mRNA to natural killer and dendritic cells within the lung. 514O6,10 can be used for the RNA therapies for lung diseases associated with immune cell dysregulation, including cancer, viral infections, and autoimmune disorders research .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

viral RNA

Inhibitors & Agonists

Screening Libraries

Biochemical Assay Reagents

Peptides

Inhibitory Antibodies

NaturalProducts

Recombinant Proteins

Isotope-Labeled Compounds

Oligonucleotides

Natural
Products