1. Search Result
Search Result
Results for "

viral RNA

" in MedChemExpress (MCE) Product Catalog:

155

Inhibitors & Agonists

2

Screening Libraries

3

Biochemical Assay Reagents

2

Peptides

1

Inhibitory Antibodies

11

Natural
Products

4

Recombinant Proteins

16

Isotope-Labeled Compounds

11

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-14768
    Favipiravir
    45+ Cited Publications

    T-705

    DNA/RNA Synthesis Influenza Virus SARS-CoV Bacterial Infection
    Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC50 of 341 nM.
    Favipiravir
  • HY-104077
    Remdesivir
    Maximum Cited Publications
    214 Publications Verification

    GS-5734

    DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir (GS-5734) is a nucleoside analogue with effective antiviral activity. Remdesivir can inhibit the synthesis of viral DNA or RNA. Remdesivir can be used for the research of infection, such as SARS-CoV and MHV infection .
    Remdesivir
  • HY-109025A
    Baloxavir
    45+ Cited Publications

    Baloxavir acid; S-033447

    Influenza Virus Infection Cancer
    Baloxavir (Baloxavir acid), derived from the proagent Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity .
    Baloxavir
  • HY-103586
    GS-441524
    25+ Cited Publications

    DNA/RNA Synthesis SARS-CoV Infection
    GS-441524 is a potent, orally active and CNS-penetrant viral RNA-dependent RNA polymerase inhibitor. GS-441524 competes with natural nucleosides to block viral RNA transcription as an alternative substrate and RNA chain terminator. GS-441524 inhibits the replication of feline infectious peritonitis virus, African swine fever virus, and severe acute respiratory syndrome coronavirus 2. GS-441524 reduces viral RNA levels in cats. GS-441524 can be used in research related to feline infectious peritonitis, African swine fever, and coronavirus disease 2019 (COVID-19) .
    GS-441524
  • HY-N0086
    N6-Methyladenosine
    Maximum Cited Publications
    7 Publications Verification

    6-Methyladenosine; N-Methyladenosine

    Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine
  • HY-153810

    JNJ-1802

    Virus Protease Flavivirus Dengue Virus Infection
    Mosnodenvir (JNJ-1802) is an orally active pan serotype dengue virus (DENV) inhibitor, with EC50 values ranging from 0.057 to 11 nM for four dengue virus (DENV) serotypes. Mosnodenvir blocks viral replication by inhibiting the formation of complexes between two viral proteins, nonstructural protein 3 (NS3) and NS4B, thereby preventing the formation of new viral RNA. Mosnodenvir exhibits picomolar to nanomolar antiviral activity in vitro and has antiviral efficacy in mice and non-human primates .
    Mosnodenvir
  • HY-126303C
    GS-443902 trisodium
    10+ Cited Publications

    GS-441524 triphosphate trisodium; Remdesivir metabolite trisodium

    DNA/RNA Synthesis SARS-CoV RSV HCV Drug Metabolite Infection
    GS-443902 trisodium (GS-441524 triphosphate trisodium) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC50s of 1.1 μM, 5 μM for RSV RdRp and HCV RdRp, respectively. GS-443902 trisodium is the active triphosphate metabolite of Remdesivir (GS-5734) .
    GS-443902 trisodium
  • HY-145586

    ZSP1273

    Influenza Virus DNA/RNA Synthesis Infection
    Onradivir (ZSP1273) is an orally active antiviral agent targeting influenza A virus RNA polymerase PB2 subunit with an IC50 of 0.562 nM. Onradivir inhibits cap binding to influenza A virus RNA polymerase PB2 subunit, suppresses viral replication, reduces viral titres and RNA loads, and inhibits influenza A virus infection. Onradivir maintains high survival rates in influenza A virus-infected mice, and reduces influenza A virus titers in a murine model. Onradivir can be used for the research of influenza A virus infection .
    Onradivir
  • HY-18649
    Galidesivir hydrochloride
    10+ Cited Publications

    BCX4430 hydrochloride; Immucillin-A hydrochloride

    DNA/RNA Synthesis SARS-CoV Filovirus Infection
    Galidesivir (BCX4430) hydrochloride, an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir hydrochloride is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir hydrochloride inhibits some negative-sense RNA viruses with EC50s ranging from ~3 to ~68 μM .
    Galidesivir hydrochloride
  • HY-18649A
    Galidesivir
    10+ Cited Publications

    BCX4430; Immucillin-A

    DNA/RNA Synthesis SARS-CoV Filovirus Infection
    Galidesivir (BCX4430), an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir inhibits some negative-sense RNA viruses with EC50s ranging from ~3 to ~68 μM .
    Galidesivir
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-30234A
    Clemizole hydrochloride
    1 Publications Verification

    Histamine Receptor TRP Channel HCV Protease HCV Inflammation/Immunology Endocrinology Cancer
    Clemizole hydrochloride is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole hydrochloride is an inhibitor of TRPC5 channel. The IC50 of Clemizole hydrochloride for RNA binding by NS4B is 24 nM, whereas its EC50 for viral replication is 8 μM.
    Clemizole hydrochloride
  • HY-W015764
    T-1105
    2 Publications Verification

    Flavivirus Infection
    T-1105, a structural analogue of T-705, is a novel broad-spectrum viral polymerase inhibitor. T-1105 inhibits the polymerases of RNA viruses after being converted to ribonucleoside triphosphate (RTP) metabolite. T-1105 has antiviral activity against various RNA viruses. T-1105 can be formed by nicotinamide mononucleotide adenylyltransferase .
    T-1105
  • HY-145994
    Obeldesivir
    1 Publications Verification

    ATV006

    SARS-CoV Infection
    Obeldesivir (ATV006) is a potent, orally active antiviral agent and ester proagents of GS-441524. Obeldesivir inhibits the replication of SARS-CoV-2 and its variants. Obeldesivir can be used for SARS-CoV-2 research .
    Obeldesivir
  • HY-14837

    Enisamium iodide

    Influenza Virus SARS-CoV Infection
    Amizon is an orally effective antiviral and anti-inflammatory agent. Amizon inhibits influenza virus replication and restricts viral RNA synthesis. Amizon reduces the mRNA expression of COX-1, COX-2, NF-κB, TGF1β, IL-1 and IL-6, and stimulates the secretion and mRNA expression of IL-10. Amizon inhibits the oxidative activity of macrophages and possesses antioxidant and free radical-scavenging activities. Amizon is applicable to research related to influenza and acute respiratory viral infections .
    Amizon
  • HY-122587

    DNA/RNA Synthesis RSV Infection
    AVG-233 is a potent, orally active RNA dependent RNA polymerase (RdRp) inhibitor. AVG-233 prevents initiation of the viral polymerase complex at the promoter. AVG-233 binding site is present in the L1-1749 fragment. AVG-233 has nanomolar activity against both RSV strains and clinical RSV isolates (EC50=0.14-0.31 μM). AVG-233 can be used for research of respiratory syncytial virus (RSV) .
    AVG-233
  • HY-137697D

    HIV DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Drug Metabolite HIV Protease Infection
    ddCTP trilithium solution (100 mM) is a chain-terminating dideoxynucleotide. ddCTP trilithium is a type of chain-terminating deoxynucleotide. ddCTP trilithium can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP trilithium can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP trilithium is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .
    ddCTP trisodium solution (100 mM)
  • HY-19743
    Triazavirin
    1 Publications Verification

    Nucleoside Antimetabolite/Analog Influenza Virus DNA/RNA Synthesis Infection
    Triazavirin is a nucleoside analogue of nucleic acid and an antiviral agent. Triazavirin works by inhibiting the synthesis of viral RNA and DNA and replication of genomic fragments. Triazavirin is also an effective protective agent on the transmission stage of influenza .
    Triazavirin
  • HY-126303

    GS-441524 triphosphate; Remdesivir metabolite

    DNA/RNA Synthesis SARS-CoV RSV HCV Drug Metabolite Infection
    GS-443902 (GS-441524 triphosphate) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC50s of 1.1 µM, 5 µM for RSV RdRp and HCV RdRp, respectively. GS-443902 is the active triphosphate metabolite of Remdesivir .
    GS-443902
  • HY-N8533

    DNA/RNA Synthesis Infection Cancer
    Sodium Camptothecin is a plant alkaloid, with antitumor activity. Sodium Camptothecin is a reversible inhibitor of RNA synthesis. Sodium Camptothecin is an effective inhibitor of adenovirus replication. Sodium Camptothecin inhibits DNA synthesis and causes breaks in intracellular preformed viral DNA .
    Sodium Camptothecin
  • HY-W013403

    IFNAR Infection
    2'-Deoxy-2'-fluorouridine is a derivative of the pyrimidine nucleoside uridine. 2'-Deoxy-2'-fluorouridine is a nucleoside analog that inhibits the replication of wild-type viruses by binding to the viral RNA. Hepatitis C polyU/UC RNA strands containing 2'-Deoxy-2'-fluorouridine, bind to RIG-I but do not activate RIG-I signaling in a reporter assay using Huh7 cells. 2'-Deoxy-2'-fluorouridine also has been used as a starting material in the synthesis of respiratory syncytial virus (RSV) polymerase inhibitors. 2'-Deoxy-2'-fluorouridine can incorporate into DNA and RNA in rat and woodchuck model upon administration. 2'-Deoxy-2'-fluorouridine can be studied in anti-viral research .
    2'-Deoxy-2'-fluorouridine
  • HY-135867E
    NHC-triphosphate tetraammonium
    5+ Cited Publications

    CHIKV Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV Infection
    NHC-triphosphate tetraammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate tetraammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .
    NHC-triphosphate tetraammonium
  • HY-131603

    3TCTP

    Reverse Transcriptase HCV HBV SARS-CoV Drug Derivative Infection
    Lamivudine triphosphate (3TCTP) is a phosphorylated Lamivudine (HY-B0250) (a nucleoside analogue). Lamivudine triphosphate inhibits the reverse transcriptase of HIV or HBV viruses to block viral replication by chain termination. Lamivudine triphosphate is also an inhibitor of the RdRp activity of the NS5B subunit of the HCV. Lamivudine triphosphate can be incorporated into the nascent RNA by the SARS-CoV-2 RdRp, thus halting mutations in the nascent SARS-CoV-2 RNA .
    Lamivudine triphosphate
  • HY-W250152

    Biochemical Assay Reagents Inflammation/Immunology
    Polycytidylic acid potassium is an immunostimulant and synthetic double-stranded RNA. Polycytidylic acid potassium can be used experimentally to model viral infections in vivo. Polycytidylic acid potassium is a common tool in immune system research .
    Polycytidylic acid potassium
  • HY-126113

    Flavivirus Dengue Virus RIG-I-like receptor (RLR) Influenza Virus HCV Infection
    KIN101 is a potent RNA viral inhibitor with IC50s of 2 μM, >5 μM for influenza virus and Dengue virus (DNV), respectively. KIN101, an isoflavone agonist of IRF-3 dependent signaling, induces IRF-3 nuclear translocation. KIN101 has broad-spectrum activity against RNA viruses .
    KIN101
  • HY-106312A

    LY122772

    Enterovirus Infection
    Enviroxime (LY122772) is an antiviral compound that inhibits the replication of rhinoviruses and enteroviruses. Enviroxime blocks the replication of plus-strand viral RNA by targeting the viral 3A coding region. Enviroxime can be a useful tool for investigating the natural function of the 3A protein .
    Enviroxime
  • HY-10118
    Filibuvir
    4 Publications Verification

    HCV DNA/RNA Synthesis Infection
    Filibuvir is an orally active, selective non-nucleoside inhibitor of the HCV nonstructural 5B protein (NS5B) RNA-dependent RNA polymerase (RdRp). Filibuvir binds noncovalently in the thumb II allosteric pocket of NS5B. Filibuvir inhibits genotype 1a and 1b replicons with EC50s of 59 nM for both isoforms, respectively . Filibuvir preferentially inhibits elongative RNA synthesis and potently decreases viral RNA accumulation .
    Filibuvir
  • HY-30234
    Clemizole
    1 Publications Verification

    Histamine Receptor TRP Channel HCV Protease HCV Inflammation/Immunology Endocrinology Cancer
    Clemizole is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole is an inhibitor of TRPC5 channel. The IC50 of Clemizole for RNA binding by NS4B is 24±1 nM, whereas its EC50 for viral replication is 8 µM.
    Clemizole
  • HY-44358
    Remdesivir nucleoside monophosphate
    3 Publications Verification

    Drug Metabolite DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir nucleoside monophosphate is a metabolite of Remdesivir (HY-104077). Remdesivir is a nucleoside analogue with effective antiviral activity. Remdesivir can inhibit the synthesis of viral DNA or RNA. Remdesivir can be used for the research of infection, such as SARS-CoV and MHV infection .
    Remdesivir nucleoside monophosphate
  • HY-155386

    Biochemical Assay Reagents Enterovirus DNA/RNA Synthesis Mitochondrial Metabolism Infection Neurological Disease
    Peroxynitrite sodium is a product of the diffusion-controlled reaction between nitric oxide and superoxide radicals, as well as an oxidant and an antiviral agent. Peroxynitrite sodium inhibits Mitochondrial respiration. Peroxynitrite sodium suppresses the replication of Coxsackievirus, partly by inhibiting viral RNA entry into host cells. Peroxynitrite sodium induces a significant nociceptive response .
    Peroxynitrite sodium
  • HY-153228
    Pomotrelvir
    1 Publications Verification

    PBI-0451

    SARS-CoV Infection
    Pomotrelvir is a selective, competitive, orally active covalent inhibitor of the SARS-CoV-2 main protease (M pro), with an IC50 of 24 nM for wild-type SARS-CoV-2 M pro. Pomotrelvir inhibits viral polyprotein processing, thereby preventing viral replication. Pomotrelvir has shown broad antiviral activity against multiple SARS-CoV-2 variants (including Omicron) in cell-based experiments, and has an additive effect when combined with nucleoside analogs that target viral RNA synthesis. Pomotrelvir is primarily used for the research and development of COVID-19 antiviral drugs, especially for infections caused by SARS-CoV-2 and its variants .
    Pomotrelvir
  • HY-156215

    HCV Infection
    NCI-B16 is a small molecule RNA binder and inhibits HCV viral replication .
    NCI-B16
  • HY-103586A
    GS-441524 hydrochloride
    25+ Cited Publications

    DNA/RNA Synthesis SARS-CoV Infection
    GS-441524 hydrochloride is a potent, orally active and CNS-penetrant viral RNA-dependent RNA polymerase inhibitor. GS-441524 hydrochloride competes with natural nucleosides to block viral RNA transcription as an alternative substrate and RNA chain terminator. GS-441524 hydrochloride inhibits the replication of feline infectious peritonitis virus, African swine fever virus, and severe acute respiratory syndrome coronavirus 2. GS-441524 hydrochloride reduces viral RNA levels in cats. GS-441524 hydrochloride can be used in research related to feline infectious peritonitis, African swine fever, and coronavirus disease 2019 (COVID-19) .
    GS-441524 hydrochloride
  • HY-137697

    Nucleoside Antimetabolite/Analog DNA/RNA Synthesis HIV Protease HIV Drug Metabolite Infection
    ddCTP is a type of chain-terminating deoxynucleotide. ddCTP can be incorporated into the extension primer chain that lacks the 3'-hydroxyl group, thereby terminating primer extension, viral genome replication, and DNA synthesis. ddCTP can distinguish almost identical RNA through distinguishable extension products in primer extension inhibition experiments. ddCTP is the active metabolite of Zalcitabine (HY-17392), which can competitively inhibit HIV reverse transcriptase, terminate the synthesis of viral DNA chains, and thereby inhibit HIV replication .
    ddCTP
  • HY-W269306

    DNA/RNA Synthesis Influenza Virus Infection
    Bonaphthone is an antiviral agent with anti-DNA and -RNA viral activities .
    Bonaphthone
  • HY-172918

    Influenza Virus Arenavirus Infection
    VV261 is an orally active prodrug of 4'-fluorouridine. VV261 inhibits viral RNA-dependent RNA polymerase. VV261 exhibits antiviral activity against CCHFV, SFTSV and LCMV. VV261 can be used in research related to viral infections .
    VV261
  • HY-W128400

    DNA/RNA Synthesis HCV Infection
    3′-Deoxy-3′-fluoroguanosine exhibits antiviral activity against tick-borne encephalitis virus (TBEV), through interaction with NS5B RdRp of HCV, resulting in suppression of viral RNA synthesis by disruption of further extension of the replicating viral RNA .
    3′-Deoxy-3′-fluoroguanosine
  • HY-159067

    DEAE-dextran, MW 500000 hydrochloride, from bacterial (Leuconostoc mesenteroides); Diethylaminoethyl-dextran, MW 500000 hydrochloride

    Biochemical Assay Reagents Cancer
    DEAE-dextran, MW 500000 hydrochloride (DEAE-dextran, MW 500000 hydrochloride, from bacterial (Leuconostoc mesenteroides)) is a high-molecular-weight positively charged polymer that significantly enhances the uptake of viral RNA by tissue culture cells. When employed in the delivery system for "tumor immunity" RNA-splenocyte transfer, DEAE-dextran can markedly extend the lifespan of tumor-bearing animals, comparable to that of actively immunized animals. Furthermore, DEAE-dextran serves as a complexing agent for nucleic acids, forming composite particles with DNA/RNA for extensive applications in gene delivery. Additionally, DEAE-dextran can be utilized as a coating for liposomes .
    DEAE-dextran, MW 500000 hydrochloride
  • HY-111233

    WIN-51711

    Enterovirus Infection
    Disoxaril (WIN-51711) is an antivirus agent with activity against poliovirus types 1 and 2. Disoxaril inserts into the hydrophobic interior of virus capsid protein VP1 to stabilize virion conformation, inhibits poliovirus uncoating, and prevents viral RNA release and synthesis. Disoxaril can be used for the research of poliovirus infection .
    Disoxaril
  • HY-177817

    RIG-I-like receptor (RLR) Infection
    CL9 sodium, a RIG-I-specific RNA aptamer, activates signaling pathways for IFNβ produciton and efficiently blocks viral replication. RIG-I is a cytosolic receptor for non-self RNA that mediates immune responses against viral infections through IFNα/β prod
    CL9 sodium
  • HY-W555382

    2-Nonylquinolin-4(1H)-one

    HCV Infection
    Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC50 value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .
    Pseudane IX
  • HY-104077R

    GS-5734 (Standard)

    Reference Standards DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir (Standard) (GS-5734 (Standard)) is a nucleoside analogue with effective antiviral activity. Remdesivir (Standard) can inhibit the synthesis of viral DNA or RNA. Remdesivir (Standard) can be used for the research of infection, such as SARS-CoV and MHV infection .
    Remdesivir (Standard)
  • HY-19643

    HCV Protease Infection
    JTK-109 is a potent inhibitor of hepatitis C virus NS5B RNA-dependent RNA polymerase. JTK-109 has NS5B inhibitory activity with IC50 value of 0.017μM. JTK-109 can be used for the research of hepatitis C virus (HCV) .
    JTK-109
  • HY-135867

    CHIKV Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV Infection
    NHC-triphosphate is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .
    NHC-triphosphate
  • HY-148781

    HBV Infection
    HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .
    HBV-IN-30
  • HY-148167

    DNA/RNA Synthesis Virus Protease Infection
    2'-Deoxy-2'-fluoro-l-uridine is an L-nucleoside compound. 2'-Deoxy-2'-fluoro-l-uridine is a potent, selective viral RNA polymerase inhibitor, thereby inhibiting RNA virus replication .
    2'-Deoxy-2'-fluoro-l-uridine
  • HY-162793

    DNA/RNA Synthesis Influenza Virus Infection
    RdRP-IN-8 (compound 45) is an anti-influenza virus compound. RdRP-IN-8 inhibits viral RNA-dependent RNA polymerase (RdRP) activity by disrupting heterodimerization of PA and PB1 subunits (EC50=0.13 μM) .
    RdRP-IN-8
  • HY-113761

    Filovirus Infection
    ASN03576800 could be a potent inhibitor for Ebola virus matrix protein VP40 in process of viral assembly and budding process. ASN03576800 occupies the RNA binding region of VP40 .
    ASN03576800
  • HY-135867A

    CHIKV Endogenous Metabolite Enterovirus HCV Topoisomerase Infection
    NHC-triphosphate tetrasodium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form . NHC-triphosphate tetrasodium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA .
    NHC-triphosphate tetrasodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: