Antisense Oligonucleotides

Viltolarsen (NS-065/NCNP-01) sodium is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen sodium binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen sodium has the potential for Duchenne muscular dystrophy (DMD) research.

Custirsen sodium is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.

Eteplirsen (AVI 4658) sodium is a phosphorylated diamine morpholino oligonucleotide that targets exon 51 of the human Duchenne muscular dystrophy (DMD) gene. Eteplirsen sodium induces exon 51 skipping, causing it to be skipped during splicing, thereby restoring the translation reading frame and producing a shortened functional dystrophin. Eteplirsen sodium can be used in research on Duchenne muscular dystrophy.

Apatorsen (OGX-427) sodium is a 2'-methoxyethyl-modified antisense oligonucleotide and also a Hsp27 inhibitor. Apatorsen sodium reduces Hsp27 mRNA and protein levels, impairs stress-induced cytoprotective functions, induces cell apoptosis, inhibits tumor growth and prevents metastasis. Apatorsen sodium is applicable to research related to non-small cell lung cancer, castration-resistant prostate cancer, breast cancer, ovarian cancer and bladder cancer.

Imetelstat (GRN163L) is a 13-mer oligonucleotide and competitive Telomerase inhibitor. Imetelstat binds with high affinity to the template region of the RNA component of human telomerase. Imetelstat induces Apoptosis. Imetelstat is capable of selectively eliminating myelofibrosis hematopoietic stem cells. Imetelstat leads to the loss of a cancer cell's ability to maintain telomere length, resulting in the inhibition of cell proliferation.

ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .

Prexigebersen sodium is an antisense oligonucleotide designed to inhibit protein synthesis of Grb2 (growth factor receptor bound protein 2).

Farabursen (RGLS8429; RG1015) is a blood-brain barrier-permeable miR-17 inhibitor. Farabursen derepresses Pkd1 and Pkd2, the target genes of miR-17, increases the levels of PC1 and PC2, and reduces cyst growth. Farabursen decreases renal cyst growth, kidney weight-to-body weight ratio, cyst index, proliferation index, and blood urea nitrogen levels in mouse models. Farabursen is applicable to research related to autosomal dominant polycystic kidney disease.

Diranersen (IONIS-MAPTRx) is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen can be used in research related to Alzheimer's disease and tauopathies.

Fomivirsen (ISIS-2922) is an antisense phosphorothioate oligonucleotide. Fomivirsen is an antiviral reagent used in research on cytomegalovirus (CMV) retinitis. Fomivirsen binds to and degrades the mRNA of CMV immediate-early 2 protein, thereby inhibiting viral proliferation. Fomivirsen can be used in research related to cytomegalovirus retinitis and cytomegalovirus diseases.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Diranersen (IONIS-MAPTRx) sodium is an antisense oligonucleotide that targets the human MAPT gene to inhibit the production of tau protein. Diranersen sodium can be used in research related to Alzheimer's disease and tauopathies.

Trecovirsen (GEM91) is an antiviral agent targeting HIV gag mRNA, which hybridizes with complementary HIV gag mRNA at the initiation site. Trecovirsen induces a reversible, dose-dependent prolongation of activated partial thromboplastin time via its polyanionic property. Trecovirsen is applicable to research related to HIV infection.

Eplontersen sodium the sodium salt form of Eplontersen (HY-148089). Eplontersen sodium is a triantennary N-acetyl galactosamine (GalNAc₃-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases.

Trabedersen (AP 12009) sodium is an orally active synthetic antisense phosphorothioate oligodeoxynucleotide that selectively targets human TGFβ2 mRNA. Trabedersen sodium blocks TGFβ2 protein production, enters the nucleus without a transfection vector, and exerts dose-dependent antitumor effects. By reversing TGFβ2-induced immunosuppression and enhancing immune cytotoxicity, Trabedersen sodium exhibits significant antiproliferative, antimigratory, and antimetastatic activities, with favorable safety profiles. Trabedersen sodium is widely used in research related to various solid tumors, including anaplastic astrocytoma, glioblastoma, colorectal tumor, and melanoma.

Inotersen (GSK-2998728; ISIS-420915) is a 2'-O-methoxyethyl-modified antisense oligonucleotide and transthyretin (TTR) inhibitor with low genotoxicity. Inotersen triggers RNase H1-mediated degradation by binding to TTR mRNA, thereby effectively reducing the production of both mutant and wild-type transthyretin in the liver. Inotersen significantly reduces amyloid fiber deposition, yet specific toxicities such as inflammation or tumors are observed at high doses in some animal models. Inotersen is used in studies of hereditary transthyretin amyloidosis and the associated polyneuropathy and cardiomyopathy.

Danvatirsen sodium (AZD9150 sodium) is an antisense oligonucleotide targeting STAT3. Danvatirsen sodium reduces the viability and promotes apoptosis of leukemia cell lines. Danvatirsen sodium inhibits the expression of endogenous STAT3 and its downstream target genes, and reduces the proliferation and tumorigenicity of neuroblastoma and lymphoma cells. Danvatirsen sodium inhibited tumor growth in mouse models of neuroblastoma, lymphoma, and non-small cell lung cancer. Danvatirsen sodium achieves STAT3 mRNA and protein depletion in a mouse model of epidermoid carcinoma. Danvatirsen sodium can be used in research related to lymphoma, myelodysplastic syndrome, acute myeloid leukemia, neuroblastoma and non-small cell lung cancer.

Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD).

Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications

Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .