HBV
Hepatitis B virus
All Product Categories
-
HBV Related Products (383)
Related Products (383)
-
Antibodies (2)
-
Bepirovirsen
0 ImagesCat. No.: HY-147217CAS No.: 1403787-62-1Synonyms: ISIS 505358Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC). -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Oxethazaine
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Famciclovir
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Elebsiran sodium
0 ImagesCat. No.: HY-147266Synonyms: VIR-2218 sodiumElebsiran (VIR-2218) sodium is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran sodium leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran sodium binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran sodium can be used for the study of chronic HBV/HDV infections. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Pseudolaric Acid B
0 ImagesPseudolaric Acid B is an orally active diterpene acid. Pseudolaric Acid B has anti-fungal, anti-fertility, anti-angiogenesis and anticancer activity, and can induce tumor cell apoptosis and autophagy. In addition, Pseudolaric Acid B can inhibit the secretion of hepatitis B virus (HBV) and has immunosuppressive effect, selectively inhibiting the proliferation of T lymphocytes and the production of IL-2. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Swertisin
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Azvudine hydrochloride
0 ImagesSynonyms: RO-0622 hydrochloride; FNC hydrochlorideAzvudine (RO-0622) hydrochloride is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine hydrochloride exerts highly potent inhibition on HIV-1 (EC50s ranging from 0.03 to 6.92 nM) and HIV-2 (EC50s ranging from 0.018 to 0.025 nM). Azvudine hydrochloride inhibits NRTI-resistant viral strains. Azvudine (hydrochloride) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Bersacapavir
0 ImagesSynonyms: JNJ-6379; JNJ-56136379Bersacapavir (JNJ-6379) is an HBV capsid assembly modulator. Bersacapavir exerts a dual mechanism of action against both early and late stages of HBV infection by forming complete genome-free empty capsids and inhibiting de novo synthesis of cccDNA. Bersacapavir inhibits HBV replication. Bersacapavir can be used in the research of hepatitis B. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
β-Thujaplicinol
0 ImagesSynonyms: 3-Hydroxy-5-isopropyltropolone -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Tenofovir Disoproxil
0 ImagesSynonyms: Bis(POC)-PMPA; GS 4331Tenofovir Disoproxil (Bis(POC)-PMPA) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Bay 41-4109
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Evixapodlin
0 ImagesSynonyms: GS-4224; PD-1/PD-L1-IN 7Evixapodlin (GS-4224) is a human PD-1/PD-L1 protein/protein interaction inhibitor with an IC50 of 0.213 nM. Evixapodlin has anticancer and antiviral functions. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Vonafexor
0 ImagesSynonyms: EYP001 -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- NVR 3-778
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Daphnoretin
0 ImagesDaphnoretin (Dephnoretin; Thymelol) is a protein kinase C (PKC) activator that inhibits the expression of hepatitis B virus (HBV) surface antigen (HBsAg) and exhibits antiviral activity. Daphnoretin exerts its antitumor effects by inhibiting the activation of the PI3K/AKT signaling pathway and triggers the mitochondrial apoptosis pathway. Daphnoretin alleviates chondrocyte apoptosis and inflammatory responses by inhibiting endoplasmic reticulum stress and activation of the NLRP3 inflammasome. Daphnoretin regulates the differentiation and maturation of dendritic cells, inhibits their immunostimulatory function by downregulating the phosphorylation level of JNK, and thus exerts a protective effect in skin graft rejection. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
- Adenosylhomocysteinase
-
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Taribavirin hydrochloride
0 ImagesTaribavirin hydrochloride is an orally active inosine monophosphate dehydrogenase inhibitor, has activity against a wide range of viruses, especially the hepatitis C virus and influenza virus. Taribavirin hydrochloride is a Ribavirin proagent, is designed to concentrate within the liver to target HCV-infected hepatocytes while minimizing distribution within red blood cells (RBCs) and the development of hemolytic anemia. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
Pevifoscorvir sodium
0 ImagesSynonyms: ALG-000184Pevifoscorvir sodium is an orally active inhibitor of hepatitis B virus (HBV), and it is also a prodrug of ALG-001075 (HY-177022). Pevifoscorvir sodium can inhibit the production of HBV DNA in liver cells. Pevifoscorvir sodium can be used in the research of chronic hepatitis B. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
1,2-Didocosahexaenoyl-sn-glycero-3-phosphocholine
0 ImagesCat. No.: HY-142989CAS No.: 99296-81-81,2-Didocosahexaenoyl-sn-glycero-3-phosphocholine is a polyunsaturated phospholipid that serves as a component of lipid monolayers and small unilamellar vesicles. 1,2-Didocosahexaenoyl-sn-glycero-3-phosphocholine can be used to prepare endoplasmic reticulum-targeted liposomes (PERLs), which are composed of 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, l-α-phosphatidylinositol and l-α-phosphatidylserine at a molar ratio of 1.5:1.5:1:1. PERLs reduce cholesterol levels in human peripheral blood mononuclear cells (PBMCs) and decrease HIV-1 particle secretion from HIV-1-infected PBMCs. Liposomes formed from 1,2-Didocosahexaenoyl-sn-glycero-3-phosphocholine exhibit cytotoxicity against leukemia cells. 1,2-Didocosahexaenoyl-sn-glycero-3-phosphocholine is applicable to studies related to hepatitis C virus infection, HIV infection, hepatitis B virus infection and leukemia. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
-
GLP-26
0 ImagesGLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools. GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups. -
loading...Please select quantityGet Quote
August 31
-
Please select quantity
August 31
Get Quote
loading... -
No matching results
No matching results
No matching results
No matching results
No matching results
No matching results
No matching results
No matching results
No matching results
No matching results