HBV
Hepatitis B virus
HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.
All Product Categories
-
HBV Related Products (378)
Related Products (378)
-
Antibodies (2)
-
Tobevibart
0 ImagesSynonyms: VIR-3434Tobevibart (VIR-3434) is a human IgG1 lambda monoclonal antibody against hepatitis B virus (HBV) surface antigen (HBsAg). Tobevibart shows potent neutralization against HBsAg from all HBV genotypes in vitro and inhibits viral entry of HBV and hepatitis delta virus (HDV). Recommend Isotype Controls: Human IgG1 lambda2, Isotype Control (HY-P990096).
-
4-Hydroxyacetophenone
0 Images4-Hydroxyacetophenone (P-hydroxyacetophenone) is a major hepatoprotective and choleretic compound found in Artemisia and Illicium plants, exhibiting antiviral and anti-inflammatory effects against hepatitis B virus. Additionally, 4-Hydroxyacetophenone inhibits cancer cell adhesion, invasion, and migration by remodeling actin. 4-Hydroxyacetophenone holds promise for research in the fields of inflammatory diseases and cancer.
-
Bepirovirsen
0 ImagesCat. No.: HY-147217CAS No.: 1403787-62-1Synonyms: ISIS 505358Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
-
Oxethazaine
0 ImagesOxethazaine (Oxetacaine), a precursor of phentermine?acidic, is an acid-resistent and orally active analgesic agent. Oxethazaine (Oxetacaine) has the potential for the relief of pain associated with?peptic ulcer disease?or?esophagitis.
-
Elebsiran sodium
0 ImagesCat. No.: HY-147266Synonyms: VIR-2218 sodiumElebsiran (VIR-2218) sodium is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran sodium leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran sodium binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran sodium can be used for the study of chronic HBV/HDV infections.
-
Pseudolaric Acid B
0 ImagesPseudolaric Acid B is an orally active diterpene acid. Pseudolaric Acid B has anti-fungal, anti-fertility, anti-angiogenesis and anticancer activity, and can induce tumor cell apoptosis and autophagy. In addition, Pseudolaric Acid B can inhibit the secretion of hepatitis B virus (HBV) and has immunosuppressive effect, selectively inhibiting the proliferation of T lymphocytes and the production of IL-2.
-
Azvudine hydrochloride
0 ImagesSynonyms: RO-0622 hydrochloride; FNC hydrochlorideAzvudine (RO-0622) hydrochloride is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine hydrochloride exerts highly potent inhibition on HIV-1 (EC50s ranging from 0.03 to 6.92 nM) and HIV-2 (EC50s ranging from 0.018 to 0.025 nM). Azvudine hydrochloride inhibits NRTI-resistant viral strains. Azvudine (hydrochloride) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
-
Bersacapavir
0 ImagesSynonyms: JNJ-6379; JNJ-56136379Bersacapavir (JNJ-6379) is an HBV capsid assembly modulator. Bersacapavir exerts a dual mechanism of action against both early and late stages of HBV infection by forming complete genome-free empty capsids and inhibiting de novo synthesis of cccDNA. Bersacapavir inhibits HBV replication. Bersacapavir can be used in the research of hepatitis B.
-
β-Thujaplicinol
0 ImagesSynonyms: 3-Hydroxy-5-isopropyltropolone
-
Tenofovir Disoproxil
0 ImagesSynonyms: Bis(POC)-PMPA; GS 4331Tenofovir Disoproxil (Bis(POC)-PMPA) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B.
-
Evixapodlin
0 ImagesSynonyms: GS-4224; PD-1/PD-L1-IN 7Evixapodlin (GS-4224) is a human PD-1/PD-L1 protein/protein interaction inhibitor with an IC50 of 0.213 nM. Evixapodlin has anticancer and antiviral functions.
-
Daphnoretin
0 ImagesDaphnoretin (Dephnoretin; Thymelol) is a protein kinase C (PKC) activator that inhibits the expression of hepatitis B virus (HBV) surface antigen (HBsAg) and exhibits antiviral activity. Daphnoretin exerts its antitumor effects by inhibiting the activation of the PI3K/AKT signaling pathway and triggers the mitochondrial apoptosis pathway. Daphnoretin alleviates chondrocyte apoptosis and inflammatory responses by inhibiting endoplasmic reticulum stress and activation of the NLRP3 inflammasome. Daphnoretin regulates the differentiation and maturation of dendritic cells, inhibits their immunostimulatory function by downregulating the phosphorylation level of JNK, and thus exerts a protective effect in skin graft rejection.
-
Adenosylhomocysteinase
0 ImagesAdenosylhomocysteinase (SAHH; AHCY) is a highly conserved enzyme. Adenosylhomocysteinase reversible catalyzes S-adenosylhomocysteine (SAH) to adenosine and L-homocysteine. The serum exosomal Adenosylhomocysteinase level can be used as a prognostic biomarker in HBV-LC patients.
-
Taribavirin hydrochloride
0 ImagesTaribavirin hydrochloride is an orally active inosine monophosphate dehydrogenase inhibitor, has activity against a wide range of viruses, especially the hepatitis C virus and influenza virus. Taribavirin hydrochloride is a Ribavirin proagent, is designed to concentrate within the liver to target HCV-infected hepatocytes while minimizing distribution within red blood cells (RBCs) and the development of hemolytic anemia.
