Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
42 Results for "
GGT
" in MedChemExpress (MCE) Product Catalog:
Products (42)
42 Results for "GGT" in MCE Product Catalog:
7
Target:
Research Areas:
GGsTop (Nahlsgen) is a potent, non-toxic, highly selective and irreversible γ-GGT inhibitor, with a Ki of 170 μM for Human GGT. GGsTop shows a pKa of 9.71, also exhibits Kons of 150 and 51 M -1 s -1 against E.coli GGT and human GGT, respectively. GGsTop protects hepatic ischemia-reperfusion injury in rat model .
7
7 Publications Verification
Cat. No.: HY-W011391
CAS No.: 67953-08-6
GPNA hydrochloride is a well known substrate of the enzyme γ-glutamyltransferase (GGT). GPNA hydrochloride is a specific glutamine (Gln) transporter ASCT2 inhibitor. GPNA hydrochloride also inhibit Na +-dependent carriers, such as SNAT family (SNAT1/2/4/5), and the Na +-independent leucine transporters LAT1/2. GPNA reversibly induces apoptosis in A549 cells .
5
Research Areas:
ODN TTAGGG (ODN A151), an inhibitory oligonucleotide (ODN), is a TLR9, AIM2, and cGAS antagonist. ODN TTAGGG inhibits AIM2 inflammasome activation and cGAS activation through competition with DNA. ODN TTAGGG blocks AIM2-mediated Pyroptosis and inhibits IL-18 production. ODN TTAGGG has immunosuppressive effects and can be used in research on related autoimmune diseases such as lupus erythematosus . ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3'.
3
Research Areas:
AS 1411 (AGRO-100) is an oligonucleotide aptamer targeting nucleoproteins. AS 1411 inhibits tumor cell proliferation by affecting the activity of nucleoprotein-containing complexes and can be used as a carrier to precisely deliver nanoparticles, oligonucleotides and small molecules to cancer cells. AS 1411 reduces PRMT5 expression to inhibit tumor growth in DU145 prostate cancer cells. AS 1411 works by blocking the binding of nucleoproteins to bcl-2 mRNA in MCF-7 breast cancer cells. AS 1411-coupled Jin nanospheres can inhibit breast cancer cell proliferation in vitro and in mouse models, has the ability to cross the blood-brain barrier with low tissue toxicity .
2
Target:
2
2 Cited Publications
Cat. No.: HY-W016586A
CAS No.: 161922-40-3
Synonyms: AT-125 hydrochloride; U-42126 hydrochloride
Target:
1
1 Cited Publications
Target:
Research Areas:
FGTI-2734 is a RAS C-terminal mimetic dual farnesyl transferase (FT) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC50s of 250 nM and 520 nM for FT and GGT-1, respectively. FGTI-2734 can prevent membrane localization of KRAS, hence solving KRAS resistance problem and thwarting mutant KRAS patient-derived pancreatic tumors .
1
1 Cited Publications
Research Areas:
FGTI-2734 mesylate is a RAS C-terminal mimetic dual farnesyl transferase (FT) and geranylgeranyl transferase-1 (GGT) inhibitor with IC50s of 250 nM and 520 nM for FT and GGT, respectively. FGTI-2734 mesylate can prevent membrane localization of KRAS, hence solving KRAS resistance problem and thwarting mutant KRAS patient-derived pancreatic tumors .
1
Target:
Research Areas:
γ-glutamyltransferase, Porcine kidney (GGT, Porcine kidney) is an enzyme located on the outer surface of the cell membrane. γ-glutamyltransferase, Porcine kidney maintains the physiological concentration of cytoplasmic glutathione and the cell's defense against oxidative stress by cleaving extracellular glutathione and increasing the availability of amino acids. γ-glutamyltransferase, Porcine kidney is used for pancreatic cancer research .
1
1 Cited Publications
Synonyms: ISIS 3521 sodium
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
1
1 Cited Publications
Cat. No.: HY-P700729
Purity: ≥ 95%, as determined by reducing SDS-PAGE.
Synonyms: Gamma-glutamyltransferase 1; GGT 1; CD224; GGT; GGT-1; GGTD; D22S672; D22S73; D22S732
Cat. No.: HY-148826
CAS No.: 145563-68-4
Synonyms: ARC 183; BC 007
Research Areas:
Rovunaptabin (ARC 183) is an aptamer, a single-stranded DNA molecule composed of 15 deoxynucleotides. It acts as a broad-spectrum neutralizer of pathogenic G-protein-coupled receptor autoantibodies. Rovunaptabin can be used in research related to cardiomyopathy and pulmonary hypertension .
Cat. No.: HY-150725
CAS No.: 386832-46-8
Target:
ODN 1585 is a potent inducer of IFN and TNFα production. ODN 1585 is a potent stimulator of NK (natural killer) function. ODN 1585 increases CD8+ T-cell function, including the CD8+ T cell-mediated production of IFN-γ. ODN 1585 induces regression of established melanomas in mice. ODN 1585 can confer complete protection against malaria in mice. ODN 1585 can be used for acute myelogenous leukemia (AML) and malaria research. ODN 1585 can be used as a vaccine adjuvant .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-15936
CAS No.: 63699-78-5
Synonyms: L-γ-Glutamyl-3-carboxy-4-nitroanilide ammonium salt
Cat. No.: HY-N6987
CAS No.: 29913-71-1
Target:
Research Areas:
OU749 is a potent γ-glutamyl transpeptidase (GGT) inhibitor with a Ki value of 17.6 µM. OU749 shows cytotoxicity .
Cat. No.: HY-RS18244
Target:
Research Areas:
Ggt1 Mouse Pre-designed siRNA Set A contains three designed siRNAs for Ggt1 gene (Mouse), as well as a negative control, a positive control, and a FAM-labeled negative control.
Cat. No.: HY-RS05403
Target:
Research Areas:
GGT1 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT1 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.
Cat. No.: HY-118916
CAS No.: 251577-09-0
Target:
Research Areas:
FTI-2148 is a RAS C-terminal mimetic dual farnesyl transferase (FT-1) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC50s of 1.4 nM and 1.7 μM, respectively .
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
