Search Result

Results for "

GGT

" in MedChemExpress (MCE) Product Catalog:

By Targets:	γ-Glutamyl Transferase (GGT) (10) AIM2 (1) Angiotensin Receptor (1) Apoptosis (1) ASCT (1) Bcl-2 Family (1) CDK (1) DNA/RNA Synthesis (1) Endogenous Metabolite (1) Factor Xa (1) Farnesyl Transferase (5) Fluorescent Dye (4) FXR (1) G Protein-coupled Receptor Kinase (GRK) (1) GGTase (1) Glycosidase (1) HBV (1) Histone Methyltransferase (1) IFNAR (1) Interleukin Related (1) Parasite (4) Phosphoramidites (1) PKC (1) Pyroptosis (1) Reference Standards (3) Small Interfering RNA (siRNA) (8) TNF Receptor (1) Toll-like Receptor (TLR) (3)
By Research Areas:	Cancer (18) Cardiovascular Disease (5) Endocrinology (1) Infection (7) Inflammation/Immunology (8) Metabolic Disease (1) Neurological Disease (1)
Oligonucleotides:	Aptamers (2) Thymine (1) CpG ODNs (5) Rat Pre-designed siRNA Sets (2) Mouse Pre-designed siRNA Sets (2) Human Pre-designed siRNA Sets (4) Antisense Oligonucleotides (3) Phosphoramidites (1) siRNAs (8)

Inhibitors & Agonists

Fluorescent Dye

Biochemical Assay Reagents

Natural
Products

Recombinant Proteins

Antibodies

Oligonucleotides

Targets Recommended: γ-Glutamyl Transferase (GGT)

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-108467

GGsTop 5+ Cited Publications Nahlsgen	γ-Glutamyl Transferase (GGT)	Cardiovascular Disease
GGsTop (Nahlsgen) is a potent, non-toxic, highly selective and irreversible *γ-GGT* inhibitor, with a K_i of 170 μM for Human GGT. GGsTop shows a pK_a of 9.71, also exhibits K_ons of 150 and 51 M ^-1 s ^-1 against E.coli GGT and human GGT, respectively. GGsTop protects hepatic ischemia-reperfusion injury in rat model .

HY-150751

ODN TTAGGG 3 Publications Verification ODN A151	Toll-like Receptor (TLR) AIM2 Pyroptosis Interleukin Related	Inflammation/Immunology
ODN TTAGGG (ODN A151), an inhibitory oligonucleotide (ODN), is a TLR9, AIM2, and cGAS antagonist. ODN TTAGGG inhibits AIM2 inflammasome activation and cGAS activation through competition with DNA. ODN TTAGGG blocks AIM2-mediated Pyroptosis and inhibits IL-18 production. ODN TTAGGG has immunosuppressive effects and can be used in research on related autoimmune diseases such as lupus erythematosus . ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3'.

HY-W011391

GPNA hydrochloride Maximum Cited Publications 7 Publications Verification	Apoptosis ASCT	Cancer
GPNA hydrochloride is a well known substrate of the enzyme γ-glutamyltransferase (GGT). GPNA hydrochloride is a specific glutamine (Gln) transporter ASCT2 inhibitor. GPNA hydrochloride also inhibit Na ⁺-dependent carriers, such as SNAT family (SNAT1/2/4/5), and the Na ⁺-independent leucine transporters LAT1/2. GPNA reversibly induces apoptosis in A549 cells .

HY-147081

AS 1411 2 Publications Verification AGRO-100	Histone Methyltransferase Bcl-2 Family	Cancer
AS 1411 (AGRO-100) is an oligonucleotide aptamer targeting nucleoproteins. AS 1411 inhibits tumor cell proliferation by affecting the activity of nucleoprotein-containing complexes and can be used as a carrier to precisely deliver nanoparticles, oligonucleotides and small molecules to cancer cells. AS 1411 reduces PRMT5 expression to inhibit tumor growth in DU145 prostate cancer cells. AS 1411 works by blocking the binding of nucleoproteins to bcl-2 mRNA in MCF-7 breast cancer cells. AS 1411-coupled Jin nanospheres can inhibit breast cancer cell proliferation in vitro and in mouse models, has the ability to cross the blood-brain barrier with low tissue toxicity .

HY-128350

FGTI-2734 1 Publications Verification	Farnesyl Transferase	Cancer
FGTI-2734 is a RAS C-terminal mimetic dual farnesyl transferase (FT) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC₅₀s of 250 nM and 520 nM for FT and GGT-1, respectively. FGTI-2734 can prevent membrane localization of KRAS, hence solving KRAS resistance problem and thwarting mutant KRAS patient-derived pancreatic tumors .

HY-148826

Rovunaptabin ARC 183; BC 007	G Protein-coupled Receptor Kinase (GRK)	Cardiovascular Disease
Rovunaptabin (ARC 183) is an aptamer, a single-stranded DNA molecule composed of 15 deoxynucleotides. It acts as a broad-spectrum neutralizer of pathogenic G-protein-coupled receptor autoantibodies. Rovunaptabin can be used in research related to cardiomyopathy and pulmonary hypertension .

HY-150725

ODN 1585	IFNAR TNF Receptor	Infection Inflammation/Immunology Cancer
ODN 1585 is a potent inducer of IFN and TNFα production. ODN 1585 is a potent stimulator of NK (natural killer) function. ODN 1585 increases CD8+ T-cell function, including the CD8+ T cell-mediated production of IFN-γ. ODN 1585 induces regression of established melanomas in mice. ODN 1585 can confer complete protection against malaria in mice. ODN 1585 can be used for acute myelogenous leukemia (AML) and malaria research. ODN 1585 can be used as a vaccine adjuvant .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-W016586

Acivicin 2 Publications Verification AT-125; U-42126	Parasite γ-Glutamyl Transferase (GGT)	Infection Cancer
Acivicin (AT-125), a natural product produced by Streptomyces sviceus is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin can across the blood-brain barrier and has anti-cancer, anti-parasitic properties .

HY-W016586A

Acivicin hydrochloride 2 Publications Verification AT-125 hydrochloride; U-42126 hydrochloride	Parasite	Infection Cancer
Acivicin hydrochloride (AT-125 hydrochloride), a natural product produced by Streptomyces sviceus, is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin hydrochloride can across the blood-brain barrier and has anti-cancer, anti-parasitic properties .

HY-128350A

FGTI-2734 mesylate 1 Publications Verification	Farnesyl Transferase γ-Glutamyl Transferase (GGT)	Cancer
FGTI-2734 mesylate is a RAS C-terminal mimetic dual farnesyl transferase (FT) and geranylgeranyl transferase-1 (GGT) inhibitor with IC₅₀s of 250 nM and 520 nM for FT and GGT, respectively. FGTI-2734 mesylate can prevent membrane localization of KRAS, hence solving KRAS resistance problem and thwarting mutant KRAS patient-derived pancreatic tumors .

HY-15936

L-Glutamic acid γ-(3-carboxy-4-nitroanilide) ammonium salt L-γ-Glutamyl-3-carboxy-4-nitroanilide ammonium salt	γ-Glutamyl Transferase (GGT)	Metabolic Disease
L-Glutamic acid γ-(3-carboxy-4-nitroanilide) ammonium salt is a donor substrate of gamma-glutamyltransferase (GGT) that can be used to measure GGT activity .

HY-N6987

Licraside	FXR Factor Xa	Cardiovascular Disease Inflammation/Immunology
Licraside, found in Glycyrrhiza glabra, is a Farnesoid X receptor (FXR) activator. Licraside activates FXR to induce upregulation of SHP and BSEP, regulates bile acid homeostasis, reduces elevated biliary and serum TBA, serum ALT, AST, GGT, ALP, and TBIL levels, and attenuates liver histopathological damage. Licraside inhibits factor Xa with an IC₅₀ of 48.54 mM. Licraside can be used for the research of cholestasis and thromboembolic diseases .

HY-P2997

γ-glutamyltransferase, Porcine kidney 1 Publications Verification GGT, Porcine kidney	Endogenous Metabolite	Cancer
γ-glutamyltransferase, Porcine kidney (GGT, Porcine kidney) is an enzyme located on the outer surface of the cell membrane. γ-glutamyltransferase, Porcine kidney maintains the physiological concentration of cytoplasmic glutathione and the cell's defense against oxidative stress by cleaving extracellular glutathione and increasing the availability of amino acids. γ-glutamyltransferase, Porcine kidney is used for pancreatic cancer research .

HY-148413

Aprinocarsen sodium 1 Publications Verification ISIS 3521 sodium	PKC	Cancer
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .

HY-126710

OU749	γ-Glutamyl Transferase (GGT)	Cancer
OU749 is a potent γ-glutamyl transpeptidase (GGT) inhibitor with a K_i value of 17.6 µM. OU749 shows cytotoxicity .

HY-RS18244

Ggt1 Mouse Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
Ggt1 Mouse Pre-designed siRNA Set A contains three designed siRNAs for Ggt1 gene (Mouse), as well as a negative control, a positive control, and a FAM-labeled negative control.

Ggt1 Mouse Pre-designed siRNA Set A Ggt1 Mouse Pre-designed siRNA Set A

HY-RS05403

GGT1 Human Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
GGT1 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT1 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

GGT1 Human Pre-designed siRNA Set A GGT1 Human Pre-designed siRNA Set A

HY-118916

FTI-2148	Farnesyl Transferase	Cancer
FTI-2148 is a RAS C-terminal mimetic dual farnesyl transferase (FT-1) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC₅₀s of 1.4 nM and 1.7 μM, respectively .

HY-118916A

FTI-2148 diTFA	Farnesyl Transferase	Cancer
FTI-2148 diTFA is a RAS C-terminal mimetic dual farnesyl transferase (FT-1) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC₅₀s of 1.4 nM and 1.7 μM, respectively .

HY-U00327

Prenyl-IN-1	Farnesyl Transferase GGTase	Neurological Disease
Prenyl-IN-1 is a protein prenylation inhibitor, especially a geranylgeranyltransferase (GGT) or a farnesyltransferase (FT) inhibitor, exhibiting potent activity against oxidative stress, and particularly in the treatment of Parkinson's Disease.

HY-150748

ODN D-SL01	Toll-like Receptor (TLR)	Inflammation/Immunology Cancer
ODN D-SL01, a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN D-SL01 has strong immunostimulatory activity in a variety of vertebrate species and has anticancer activity. ODN D-SL01 sequence: 5'- T-C-G-C-G-A-C-G-T-T-C-G-C-C-C-G-A-C-G-T-T-C-G-G-T-A-3' .

HY-147267

Evazarsen ISIS-757456	Angiotensin Receptor	Cardiovascular Disease Endocrinology
Evazarsen is an angiotensinogen synthesis inhibitor and possesses antihypertensive properties .

HY-RS05406

GGT7 Human Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
GGT7 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT7 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

GGT7 Human Pre-designed siRNA Set A GGT7 Human Pre-designed siRNA Set A

HY-RS05404

GGT5 Human Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
GGT5 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT5 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

GGT5 Human Pre-designed siRNA Set A GGT5 Human Pre-designed siRNA Set A

HY-RS05405

GGT6 Human Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
GGT6 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT6 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

GGT6 Human Pre-designed siRNA Set A GGT6 Human Pre-designed siRNA Set A

HY-W016586AR

Acivicin hydrochloride (Standard) AT-125 hydrochloride (Standard); U-42126 hydrochloride (Standard)	Reference Standards Parasite γ-Glutamyl Transferase (GGT)	Infection Cancer
Acivicin (hydrochloride) (Standard) is the analytical standard of Acivicin (hydrochloride). This product is intended for research and analytical applications. Acivicin hydrochloride (AT-125 hydrochloride), a natural product produced by Streptomyces sviceus, is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin hydrochloride can across the blood-brain barrier and has anti-cancer, anti-parasitic properties[1][2].

HY-RS24723

Ggt1 Rat Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
Ggt1 Rat Pre-designed siRNA Set A contains three designed siRNAs for Ggt1 gene (Rat), as well as a negative control, a positive control, and a FAM-labeled negative control.

Ggt1 Rat Pre-designed siRNA Set A Ggt1 Rat Pre-designed siRNA Set A

HY-108467R

GGsTop (Standard) Nahlsgen (Standard)	γ-Glutamyl Transferase (GGT) Reference Standards	Cardiovascular Disease
GGsTop (Standard) is the analytical standard of GGsTop. This product is intended for research and analytical applications. GGsTop (Nahlsgen) is a potent, non-toxic, highly selective and irreversible γ-GGT inhibitor, with a Ki of 170 μM for Human GGT. GGsTop shows a pKa of 9.71, also exhibits Kons of 150 and 51 M-1 s-1 against E.coli GGT and human GGT, respectively. GGsTop protects hepatic ischemia-reperfusion injury in rat model .

HY-W016586R

Acivicin (Standard) AT-125 (Standard); U-42126 (Standard)	Reference Standards Parasite γ-Glutamyl Transferase (GGT)	Infection Cancer
Articaine (Standard) is the analytical standard of Articaine. This product is intended for research and analytical applications. Articaine (Hoe-045 free base) is an amide agent that can suppress or relieve pain. containing an ester group, reversibly binding to the α-subunit of the voltage-gated sodium channels within the inner cavity of the nerve, can provide effective pain relief. Articaine ameliorates LPS-induced acute kidney injury via inhibition of NF-κB activation and the NLRP3 inflammasome pathway .

HY-146343

BMI-Glu	Fluorescent Dye γ-Glutamyl Transferase (GGT)	Inflammation/Immunology Cancer
BMI-Glu is a selective γ-glutamyl transpeptidase (GGT) fluorescent probe with a K_m of 69.63 µM. BMI-Glu has high sensitivity, good water solubility and biocompatibility .

HY-150729

ODN 1982	Toll-like Receptor (TLR)	Inflammation/Immunology
ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .

HY-150213

ODN BW001	CDK	Inflammation/Immunology
ODN BW001 is an oligodeoxynucleotide (ODN). ODN BW001 plays a regulatory role in the proliferation and activation of osteoblast .

HY-D3170

C-HBrO-GGT	Fluorescent Dye γ-Glutamyl Transferase (GGT)	Inflammation/Immunology
C-HBrO-GGT is a sequence-activated two-photon fluorescent probe. C-HBrO-GGT exhibits sequential fluorescence activation properties: it generates fluorescence in response to hypobromous acid only after being hydrolytically activated by γ-glutamyl transpeptidase. C-HBrO-GGT enables verification of the voltage-gated chloride channel (CLC-1)-HBrO-catalase (CAT)-GGT signaling pathway at the cellular level. C-HBrO-GGT can serve as a tool to indicate the precise location of mature atherosclerotic plaques and provide early warning of plaque formation. C-HBrO-GGT is applicable to relevant research on atherosclerosis .

HY-182211

GGT Trimer phosphoramidite	DNA/RNA Synthesis Phosphoramidites	Others
GGT Trimer phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.

HY-RS19902

Ggt5 Mouse Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
Ggt5 Mouse Pre-designed siRNA Set A contains three designed siRNAs for Ggt5 gene (Mouse), as well as a negative control, a positive control, and a FAM-labeled negative control.

Ggt5 Mouse Pre-designed siRNA Set A Ggt5 Mouse Pre-designed siRNA Set A

HY-RS26403

Ggt5 Rat Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
Ggt5 Rat Pre-designed siRNA Set A contains three designed siRNAs for Ggt5 gene (Rat), as well as a negative control, a positive control, and a FAM-labeled negative control.

Ggt5 Rat Pre-designed siRNA Set A Ggt5 Rat Pre-designed siRNA Set A

HY-D3188

gGlu-2OMe SiR600	Fluorescent Dye	Cancer
gGlu-2OMe SiR600 is a γ-glutamyl transpeptidase (GGT) responsive fluorescent probe. gGlu-2OMe SiR600 can be converted into a highly fluorescent molecule via reaction with *GGT*, and its initial fluorescence is quenched through a photoinduced electron transfer (PeT) mechanism. gGlu-2OMe SiR600 exhibits fluorescence activation in malignant breast cancer and benign breast fibroadenoma tissues, enabling lesion visualization. gGlu-2OMe SiR600 can be used for research related to breast cancer and fibroadenoma .

HY-D3187

HMRef-αMan	Fluorescent Dye Glycosidase	Infection Cancer
HMRef-αMan is a substrate-based green fluorescent probe (Ex/Em=465 nm/515 nm) targeting MAN2C1 (α-mannosidase). HMRef-αMan can be specifically cleaved by MAN2C1 to generate a highly fluorescent product, which thus gets activated to produce green fluorescence in malignant breast tissues, benign lesions and living cancer cells. The signal intensity of HMRef-αMan is directly correlated with MAN2C1 activity, and it can effectively detect tiny breast cancer lesions with a diameter of less than 1 mm. When used in combination with the red-emitting γ-glutamyl transpeptidase (GGT) probe gGlu-2OMe SiR600 (HY-D3188), HMRef-αMan enables precise optical differentiation of breast tissue types via a dual-color imaging strategy. HMRef-αMan has been widely used in the research of breast diseases such as breast cancer, fibroadenoma, phyllodes tumor and various types of papilloma .

Cat. No.	Product Name	Type

HY-D3170

C-HBrO-GGT	Fluorescent Dye
C-HBrO-GGT is a sequence-activated two-photon fluorescent probe. C-HBrO-GGT exhibits sequential fluorescence activation properties: it generates fluorescence in response to hypobromous acid only after being hydrolytically activated by γ-glutamyl transpeptidase. C-HBrO-GGT enables verification of the voltage-gated chloride channel (CLC-1)-HBrO-catalase (CAT)-GGT signaling pathway at the cellular level. C-HBrO-GGT can serve as a tool to indicate the precise location of mature atherosclerotic plaques and provide early warning of plaque formation. C-HBrO-GGT is applicable to relevant research on atherosclerosis .

C-HBrO-GGT

Fluorescent Dye

C-HBrO-GGT is a sequence-activated two-photon fluorescent probe. C-HBrO-GGT exhibits sequential fluorescence activation properties: it generates fluorescence in response to hypobromous acid only after being hydrolytically activated by γ-glutamyl transpeptidase. C-HBrO-GGT enables verification of the voltage-gated chloride channel (CLC-1)-HBrO-catalase (CAT)-GGT signaling pathway at the cellular level. C-HBrO-GGT can serve as a tool to indicate the precise location of mature atherosclerotic plaques and provide early warning of plaque formation. C-HBrO-GGT is applicable to relevant research on atherosclerosis .

HY-D3188

gGlu-2OMe SiR600	Fluorescent Dye
gGlu-2OMe SiR600 is a γ-glutamyl transpeptidase (GGT) responsive fluorescent probe. gGlu-2OMe SiR600 can be converted into a highly fluorescent molecule via reaction with *GGT*, and its initial fluorescence is quenched through a photoinduced electron transfer (PeT) mechanism. gGlu-2OMe SiR600 exhibits fluorescence activation in malignant breast cancer and benign breast fibroadenoma tissues, enabling lesion visualization. gGlu-2OMe SiR600 can be used for research related to breast cancer and fibroadenoma .

gGlu-2OMe SiR600

Fluorescent Dye

gGlu-2OMe SiR600 is a γ-glutamyl transpeptidase (GGT) responsive fluorescent probe. gGlu-2OMe SiR600 can be converted into a highly fluorescent molecule via reaction with GGT, and its initial fluorescence is quenched through a photoinduced electron transfer (PeT) mechanism. gGlu-2OMe SiR600 exhibits fluorescence activation in malignant breast cancer and benign breast fibroadenoma tissues, enabling lesion visualization. gGlu-2OMe SiR600 can be used for research related to breast cancer and fibroadenoma .

HY-D3187

HMRef-αMan	Fluorescent Dye
HMRef-αMan is a substrate-based green fluorescent probe (Ex/Em=465 nm/515 nm) targeting MAN2C1 (α-mannosidase). HMRef-αMan can be specifically cleaved by MAN2C1 to generate a highly fluorescent product, which thus gets activated to produce green fluorescence in malignant breast tissues, benign lesions and living cancer cells. The signal intensity of HMRef-αMan is directly correlated with MAN2C1 activity, and it can effectively detect tiny breast cancer lesions with a diameter of less than 1 mm. When used in combination with the red-emitting γ-glutamyl transpeptidase (GGT) probe gGlu-2OMe SiR600 (HY-D3188), HMRef-αMan enables precise optical differentiation of breast tissue types via a dual-color imaging strategy. HMRef-αMan has been widely used in the research of breast diseases such as breast cancer, fibroadenoma, phyllodes tumor and various types of papilloma .

HMRef-αMan

Fluorescent Dye

HMRef-αMan is a substrate-based green fluorescent probe (Ex/Em=465 nm/515 nm) targeting MAN2C1 (α-mannosidase). HMRef-αMan can be specifically cleaved by MAN2C1 to generate a highly fluorescent product, which thus gets activated to produce green fluorescence in malignant breast tissues, benign lesions and living cancer cells. The signal intensity of HMRef-αMan is directly correlated with MAN2C1 activity, and it can effectively detect tiny breast cancer lesions with a diameter of less than 1 mm. When used in combination with the red-emitting γ-glutamyl transpeptidase (GGT) probe gGlu-2OMe SiR600 (HY-D3188), HMRef-αMan enables precise optical differentiation of breast tissue types via a dual-color imaging strategy. HMRef-αMan has been widely used in the research of breast diseases such as breast cancer, fibroadenoma, phyllodes tumor and various types of papilloma .

L-Glutamic acid γ-(3-carboxy-4-nitroanilide) ammonium salt L-γ-Glutamyl-3-carboxy-4-nitroanilide ammonium salt	Biochemical Assay Reagents
L-Glutamic acid γ-(3-carboxy-4-nitroanilide) ammonium salt is a donor substrate of gamma-glutamyltransferase (GGT) that can be used to measure GGT activity .

Species:	Human (2)
Tag:	His (2)
Source:	HEK293 (2)

Cat. No.	Compare	Product Name	Species	Source	Image

HY-P700729

	GGT1 Protein, Human (HEK293, His) Gamma-glutamyltransferase 1; GGT 1; CD224; GGT; GGT-1; GGTD; D22S672; D22S73; D22S732	Human	HEK293
	The GGT1 protein cleaves gamma-glutamyl bonds of extracellular glutathione, glutathione conjugates, and other gamma-glutamyl compounds. Its metabolism releases free glutamate and cysteinylglycine, which are hydrolyzed into cysteine and glycine. GGT1 Protein, Human (HEK293, His) is the recombinant human-derived GGT1 protein, expressed by HEK293 , with N-His labeled tag.

HY-P76361

	GGT5 Protein, Human (HEK293, His) Glutathione hydrolase 5 proenzyme; GGT-rel; GGT 5; GGTLA1	Human	HEK293
	The GGT5 protein is an important glycosaminoglycan lyase that selectively cleaves heparin and heparan sulfate using a β-elimination mechanism. It targets specific linkages, such as alpha-D-GlcNp2S6S(1->4) alpha-L-IdoAp2S in heparin and alpha-D-GlcNp2Ac(or 2S)6OH(1->4)beta- in heparan sulfate D-GlcAp. GGT5 Protein, Human (HEK293, His) is the recombinant human-derived GGT5 protein, expressed by HEK293 , with N-His labeled tag.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Compare	Product Name	Application	Reactivity	Image

HY-P82889

	GGT1 Antibody (YA2634) GGT1; GGT; Gamma-glutamyltranspeptidase 1; GGT 1; Gamma-glutamyltransferase 1; Glutathione hydrolase 1; Leukotriene-C4 hydrolase; CD224	WB, IHC-P	Human
	GGT1 Antibody (YA2634) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to GGT1.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Host
Reactivity
Application
Dilution Ratio
Molecular Weight
Conjugation
Clonality
Immunogen
Appearance
Isotype
Gene ID
SwissProt ID
Purity
Formulation
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name		Classification

HY-150751

ODN TTAGGG 3 Publications Verification ODN A151		CpG ODNs
ODN TTAGGG (ODN A151), an inhibitory oligonucleotide (ODN), is a TLR9, AIM2, and cGAS antagonist. ODN TTAGGG inhibits AIM2 inflammasome activation and cGAS activation through competition with DNA. ODN TTAGGG blocks AIM2-mediated Pyroptosis and inhibits IL-18 production. ODN TTAGGG has immunosuppressive effects and can be used in research on related autoimmune diseases such as lupus erythematosus . ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3'.

HY-147081

AS 1411 2 Publications Verification AGRO-100		Aptamers
AS 1411 (AGRO-100) is an oligonucleotide aptamer targeting nucleoproteins. AS 1411 inhibits tumor cell proliferation by affecting the activity of nucleoprotein-containing complexes and can be used as a carrier to precisely deliver nanoparticles, oligonucleotides and small molecules to cancer cells. AS 1411 reduces PRMT5 expression to inhibit tumor growth in DU145 prostate cancer cells. AS 1411 works by blocking the binding of nucleoproteins to bcl-2 mRNA in MCF-7 breast cancer cells. AS 1411-coupled Jin nanospheres can inhibit breast cancer cell proliferation in vitro and in mouse models, has the ability to cross the blood-brain barrier with low tissue toxicity .

HY-148826

Rovunaptabin ARC 183; BC 007		Aptamers
Rovunaptabin (ARC 183) is an aptamer, a single-stranded DNA molecule composed of 15 deoxynucleotides. It acts as a broad-spectrum neutralizer of pathogenic G-protein-coupled receptor autoantibodies. Rovunaptabin can be used in research related to cardiomyopathy and pulmonary hypertension .

HY-150725

ODN 1585		CpG ODNs
ODN 1585 is a potent inducer of IFN and TNFα production. ODN 1585 is a potent stimulator of NK (natural killer) function. ODN 1585 increases CD8+ T-cell function, including the CD8+ T cell-mediated production of IFN-γ. ODN 1585 induces regression of established melanomas in mice. ODN 1585 can confer complete protection against malaria in mice. ODN 1585 can be used for acute myelogenous leukemia (AML) and malaria research. ODN 1585 can be used as a vaccine adjuvant .

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-148413

Aprinocarsen sodium 1 Publications Verification ISIS 3521 sodium		Antisense Oligonucleotides
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .

HY-RS18244

Ggt1 Mouse Pre-designed siRNA Set A		siRNAs Mouse Pre-designed siRNA Sets
Ggt1 Mouse Pre-designed siRNA Set A contains three designed siRNAs for Ggt1 gene (Mouse), as well as a negative control, a positive control, and a FAM-labeled negative control.

HY-RS05403

GGT1 Human Pre-designed siRNA Set A		siRNAs Human Pre-designed siRNA Sets
GGT1 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT1 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

HY-150748

ODN D-SL01		CpG ODNs
ODN D-SL01, a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN D-SL01 has strong immunostimulatory activity in a variety of vertebrate species and has anticancer activity. ODN D-SL01 sequence: 5'- T-C-G-C-G-A-C-G-T-T-C-G-C-C-C-G-A-C-G-T-T-C-G-G-T-A-3' .

HY-147267

Evazarsen ISIS-757456		Antisense Oligonucleotides
Evazarsen is an angiotensinogen synthesis inhibitor and possesses antihypertensive properties .

HY-RS05406

GGT7 Human Pre-designed siRNA Set A		siRNAs Human Pre-designed siRNA Sets
GGT7 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT7 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

HY-RS05404

GGT5 Human Pre-designed siRNA Set A		siRNAs Human Pre-designed siRNA Sets
GGT5 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT5 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

HY-RS05405

GGT6 Human Pre-designed siRNA Set A		siRNAs Human Pre-designed siRNA Sets
GGT6 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT6 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

HY-RS24723

Ggt1 Rat Pre-designed siRNA Set A		siRNAs Rat Pre-designed siRNA Sets
Ggt1 Rat Pre-designed siRNA Set A contains three designed siRNAs for Ggt1 gene (Rat), as well as a negative control, a positive control, and a FAM-labeled negative control.

HY-150729

ODN 1982		CpG ODNs
ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .

HY-150213

ODN BW001		CpG ODNs
ODN BW001 is an oligodeoxynucleotide (ODN). ODN BW001 plays a regulatory role in the proliferation and activation of osteoblast .

HY-182211

GGT Trimer phosphoramidite		Phosphoramidites Thymine
GGT Trimer phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.

HY-RS19902

Ggt5 Mouse Pre-designed siRNA Set A		siRNAs Mouse Pre-designed siRNA Sets
Ggt5 Mouse Pre-designed siRNA Set A contains three designed siRNAs for Ggt5 gene (Mouse), as well as a negative control, a positive control, and a FAM-labeled negative control.

HY-RS26403

Ggt5 Rat Pre-designed siRNA Set A		siRNAs Rat Pre-designed siRNA Sets
Ggt5 Rat Pre-designed siRNA Set A contains three designed siRNAs for Ggt5 gene (Rat), as well as a negative control, a positive control, and a FAM-labeled negative control.

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

GGT

Inhibitors & Agonists

Fluorescent Dye

Biochemical Assay Reagents

NaturalProducts

Recombinant Proteins

Antibodies

Oligonucleotides

Natural
Products