Search Result

Results for "

RNA binding protein

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA/RNA Synthesis (28) MicroRNA (7) mRNA (2) AAK1 (1) ADC Linker (1) Amyloid-β (1) Anaplastic lymphoma kinase (ALK) (1) Androgen Receptor (1) Antibiotic (20) Apoptosis (13) Bacterial (21) Bcl-2 Family (2) Biochemical Assay Reagents (3) c-Myc (1) Caspase (2) CDK (1) Cyclin G-associated Kinase (GAK) (1) DNA Methyltransferase (1) Drug Derivative (1) Early 2 Factor (E2F) (1) Endogenous Metabolite (17) Enterovirus (1) Environmental Pollutants (2) Exosomes (1) Filovirus (1) HBV (2) HCV (1) Heme Oxygenase (HO) (1) HIV (3) HSV (10) HuR (6) Insulin Receptor (3) Isotope-Labeled Compounds (12) Keap1-Nrf2 (1) LIM Kinase (LIMK) (1) Liposome (1) MDM-2/p53 (1) Mitosis (6) Molecular Glues (3) NF-κB (1) Parasite (2) PARP (1) Potassium Channel (1) PPAR (1) PROTACs (2) Pyroptosis (1) Reference Standards (6) RIBOTAC (3) Salt-inducible Kinase (SIK) (1) SARS-CoV (2) SnRK (1) Toll-like Receptor (TLR) (1) Topoisomerase (2) VEGFR (1) Wee1 (1) Wnt (1)
By Research Areas:	Cancer (38) Cardiovascular Disease (1) Infection (35) Inflammation/Immunology (3) Metabolic Disease (3) Neurological Disease (7)
Oligonucleotides:	Antigens (1) Nucleotide Analogs (1) Aptamers (2) Liposome (1) Transcription Factors (1) mRNA (2) Cap Analogs (1) Antisense Oligonucleotides (2)

Inhibitors & Agonists

Screening Libraries

Biochemical Assay Reagents

Peptides

Natural
Products

Recombinant Proteins

Isotope-Labeled Compounds

Antibodies

Oligonucleotides

Targets Recommended:

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-128933

AMP-PNP tetralithium 3 Publications Verification Adenylyl-imidodiphosphate tetralithium	Potassium Channel	Metabolic Disease
AMP-PNP (Adenylyl-imidodiphosphate) tetralithium is a non-hydrolyzable ATP analog. AMP-PNP tetralithium binds to ATP binding sites competely but is not hydrolyzed by enzymes, providing stable experimental conditions for studying ATP-dependent processes. AMP-PNP tetralithium can also be used to study enzyme activity, kinase regulation, DNA/RNA metabolism, ion channel function, and protein complex assembly .

HY-B0275

Oxytetracycline Maximum Cited Publications 10 Publications Verification	Environmental Pollutants Antibiotic Endogenous Metabolite Bacterial HSV	Infection
Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-14855

Tedizolid Maximum Cited Publications 19 Publications Verification TR 700; Torezolid; DA-7157	Bacterial Antibiotic	Infection
Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.

HY-B0275A

Oxytetracycline hydrochloride Maximum Cited Publications 10 Publications Verification	Environmental Pollutants Antibiotic Endogenous Metabolite Bacterial HSV	Infection
Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-130777A

AMP-PNP lithium hydrate 3 Publications Verification Adenylyl imidodiphosphate lithium hydrate	Drug Derivative	Metabolic Disease
AMP-PNP (Adenylyl imidodiphosphate) lithium hydrate is a non-hydrolyzable ATP analog. AMP-PNP lithium hydrate binds to ATP binding sites competely but is not hydrolyzed by enzymes, providing stable experimental conditions for studying ATP-dependent processes. AMP-PNP lithium hydrate can also be used to study enzyme activity, kinase regulation, DNA/RNA metabolism, ion channel function, and protein complex assembly .

HY-174228

I3IN-002	Insulin Receptor Apoptosis	Cancer
I3IN-002 is a small-molecule RNA-binding protein IGF2BP3 inhibitor with an IC₅₀ value of approximately 2 μM in SEM cells. I3IN-002 interferes with interaction with m6 A-modified mRNAs, disrupting the stabilization of target genes (such as CDK6, MYC, and BCL2) to inhibit leukemic cell growth, induce cell cycle arrest, and promote apoptosis. I3IN-002 is promising for research of B-cell acute lymphoblastic leukemia .

HY-B1099

Hycanthone 2 Publications Verification	DNA/RNA Synthesis Topoisomerase Parasite	Infection
Hycanthone is a thioxanthenone DNA intercalator and inhibits RNA synthesis as well as the DNA topoisomerases I and II. Hycanthone inhibits nucleic acid biosynthesis and inhibits apurinic endonuclease-1 (APE1) by direct protein binding with a K_D of 10 nM. Hycanthone is a bioactive metabolite of Lucanthone (HY-B2098) and has anti-schistosomal agent .

HY-134601

KH-3	HuR	Cancer
KH-3 is a potent RNA-binding protein Hu antigen R (HuR) inhibitor with an IC₅₀ value of 0.35 μM. KH-3 has anti-proliferative activity. KH-3 suppresses breast cancer cell invasion as well as delays the initiation of lung colonies by disrupting HuR-FOXQ1 mRNA interaction .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-122903

TK216 5+ Cited Publications	DNA/RNA Synthesis	Cancer
TK216 is an orally active and potent E26 transformation specific (ETS) inhibitor . TK216 directly binds EWS-FLI1 and inhibits EWS-FLI1 protein interactions. TK216 blocks the binding between EWS-FLI1 and RNA helicase A. TK216 has anticancer activity .

HY-153918

(R)-SKBG-1 1 Publications Verification	Androgen Receptor	Cancer
(R)-SKBG-1 is a covalent inhibitor targeting the RNA binding protein NONO. (R)-SKBG-1 can reduce the expression of androgen receptor (AR) and its splice variants, inhibiting cancer cell proliferation. (R)-SKBG-1 inhibits androgen receptor expression with IC₅₀ of 3.1 μM and 5.5 μM for AR-FL mRNA and AR-V7 mRNA, respectively. (R)-SKBG-1 interferes with the gene regulatory network of cancer cells and inhibits cancer cell growth by stabilizing the interaction between NONO and mRNA. (R)-SKBG-1 can be used in the study of cancers related to NONO dysfunction, such as prostate cancer .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-14507

YK-4-279 5+ Cited Publications	DNA/RNA Synthesis Apoptosis	Cancer
YK-4-279 blocks RNA Helicase A (RHA) binding with EWS-FLI1 (oncogenic protein). YK-4-279 induces apoptosis and shows anti-proliferation activities towards various cancer cells. YK-4-279 has a chiral center and it can be separated into two enantiomers. YK-4-279 can be used for the research of cancer .

HY-176471

IGF2BP3-IN-1	Insulin Receptor	Cancer
IGF2BP3-IN-1 (Compound I3IN-122) is an IGF2BP3 (a RNA binding protein) inhibitor (IC₅₀: > 50 μM), and can be used for cancer research .

HY-153845

RNA Aptamer Broccoli sodium	Biochemical Assay Reagents	Others
RNA Aptamer Broccoli sodium is a 49-nucleotide nucleic acid aptamer that is much shorter than Spinach and Spinach2. It exhibits bright green fluorescence when binding to DFHBI or DFHBI-1T (a soluble analog of the green fluorescent protein label). RNA Aptamer Broccoli sodium can be used for RNA expression or localization in living cells .

HY-B0275B

Oxytetracycline dihydrate Maximum Cited Publications 10 Publications Verification	Bacterial HSV Antibiotic Endogenous Metabolite	Infection
Oxytetracycline dihydrate is an antibiotic belonging to the tetracycline class. Oxytetracycline dihydrate potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline dihydrate is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline dihydrate also possesses anti-HSV-1 activity .

HY-W416291

Polyadenylic acid potassium Poly(A)	Biochemical Assay Reagents	Cancer
Polyadenylic acid potassium, also known as Poly(A), is enzymatically added to messenger RNA (mRNA) in eukaryotic cells to stabilize mRNAs. Poly(A) is used to evaluate binding on cationic liposomes doped with non-ionic nucleolipids. Poly(A) is used in small molecule mRNA targeted drug development to evaluate the binding of potential therapeutic agents such as the Isoquinoline group of alkaloids. Small molecules that could bind to this poly(A) tail could influence and possibly inhibit mRNA function and subsequent protein production in the cell leading to the development of new type of therapeutic agents.

HY-124828

CMLD-2 2 Publications Verification	HuR	Cancer
CMLD-2, an inhibitor of HuR-ARE interaction, competitively binds HuR protein disrupting its interaction with adenine-uridine rich elements (ARE)-containing mRNAs (K_i=350 nM). CMLD-2 induces apoptosis exhibits antitumor activity in different cancer cells as colon, pancreatic, thyroid and lung cancer cell lines. Hu antigen R (HuR) is an RNA binding protein, can regulate target mRNAs stability and translation .

HY-113225

Guanosine triphosphate GTP	Endogenous Metabolite DNA/RNA Synthesis Apoptosis Mitosis	Cancer
Guanosine triphosphate (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-B0268A

Enoxacin hydrate 2 Publications Verification Enoxacin sesquihydrate; AT-2266 hydrate; CI-919 hydrate	Bacterial DNA/RNA Synthesis MicroRNA Antibiotic	Infection Cancer
Enoxacin hydrate (Enoxacin sesquihydrate), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC₅₀=126 µg/ml) and topoisomerase IV (IC₅₀=26.5 µg/ml). Enoxacin hydrate is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin hydrate has potent activities against gram-positive and -negative bacteria. Enoxacin hydrate is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .

HY-B0268

Enoxacin 2 Publications Verification AT 2266; CI 919	Bacterial DNA/RNA Synthesis MicroRNA Antibiotic	Infection Cancer
Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC₅₀=126 µg/ml) and topoisomerase IV (IC₅₀=26.5 µg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .

HY-153713

MYC-RIBOTAC 1 Publications Verification	RIBOTAC c-Myc Apoptosis	Cancer
MYC-RIBOTAC is a nucleic acid-targeting degrader (ribonuclease-targeting chimera, RIBOTAC) that targets the MYC internal ribosome entry site (IRES). MYC-RIBOTAC contains a MYC mRNA binding component and a small molecule that recruits and locally activates RNAse L1. MYC-RIBOTAC reduces MYC mRNA and protein expression levels, induces cell apoptosis, and can be used for antitumor research . MYC-RIBOTAC consists of pre-miR-155 binder Anticancer agent 167 (HY-156839), RNA binder NCI-B16 (HY-156215), and Linker Amino-PEG4-alcohol (HY-W008005).

HY-21197

Perfluoroenanthic acid Perfluoroheptanoic acid; Tridecafluoroheptanoic acid; PFHpA	PPAR	Neurological Disease Metabolic Disease Inflammation/Immunology
Perfluoroenanthic acid (Perfluoroheptanoic acid) is a kind of perfluoroalkyl carboxylic acid organic pollutant. Perfluoroenanthic acid has environmental persistence and bioaccumulation, and exposure can occur via oral, dermal and other routes. Perfluoroenanthic acid exhibits reproductive toxicity, neurotoxicity, hepatotoxicity, immunotoxicity and endocrine-disrupting effects. Perfluoroenanthic acid exerts definite adverse effects on development, spermatogenesis, neuronal activity and liver tissue .

HY-175324

MG-HuR2	Molecular Glues HuR	Cancer
MG-HuR2 is a molecular glue degrader targeting the oncogenic RNA-binding protein HuR (IC₅₀=0.5 μM). MG-HuR2 is promising for research of HuR-overexpressing malignancies (e.g., breast cancer) .

HY-153235

COVID-19 Spike Protein mRNA-LNP	mRNA SARS-CoV Liposome	Infection
COVID-19 Spike Protein mRNA-LNP is a lipid nanoparticle (LNP) containing mRNA encoding COVID-19 Spike Protein. COVID-19 Spike Protein undertakes the functions of virus binding with host cell receptors, thereby mediating the entry of COVID-19 virus into cells. COVID-19 Spike Protein is an important site of action for host neutralizing antibodies and a key target for vaccine design. COVID-19 Spike Protein mRNA-LNP can be used for RNA delivery, vaccine formulation and design targeting SARS-CoV-2 .

HY-147918

Anticancer agent 73	DNA/RNA Synthesis	Cancer
Anticancer agent 73 (compound CIB-3b) is a anticancer agent, potently targeting *TAR RNA-binding* protein 2 (TRBP)** and disrupts its interaction with Dicer. Anticancer agent 73 can rebalance the expression profile of oncogenic or tumor-suppressive miRNAs. Anticancer agent 73 suppresses the proliferation and metastasis of HCC in vitro and in vivo .

HY-B0275AR

Oxytetracycline hydrochloride (Standard)	Reference Standards Bacterial HSV Antibiotic Endogenous Metabolite	Infection
Oxytetracycline (hydrochloride) (Standard) is the analytical standard of Oxytetracycline (hydrochloride). This product is intended for research and analytical applications. Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-163759

HuR degrader 2	Molecular Glues HuR	Cancer
HuR degrader 2 (Compound 3) is a molecule glue, which targets RNA-binding protein Hu antigen R (HuR) and degrades 30% HuR at 0.1 μM. HuR degrader 2 inhibits the proliferation of cancer cell Colo-205, with IC₅₀≤200 nM. HuR degrader 2 exhibits a high affinity with cereblon, with an HTRF ratio < 0.02 .

HY-153898

rTRD01	Amyloid-β	Neurological Disease
rTRD01 is an orally active, specific TDP-43 binder that targets the RRM1 and RRM2 domains of TDP-43. rTRD01 partially disrupts the interaction between TDP-43 and c9orf72 repeat RNA, but does not affect the binding of TDP-43 to canonical binding sequences. rTRD01 exhibits significant neuroprotective effects in zebrafish models, improves motor function and protects against paraquat (a widely used herbicide)-induced neurodegeneration, with no teratogenicity at high concentrations. rTRD01 is not a general antioxidant and cannot counteract Rotenone (HY-B1756)-induced neuronal death. rTRD01 can be used to study amyotrophic lateral sclerosis and other TDP-43 proteinopathies .

HY-172158

ALKBH5-IN-5 1 Publications Verification	Anaplastic lymphoma kinase (ALK) Caspase	Cancer
ALKBH5-IN-5 is a highly selective ALKBH5 (IC₅₀ = 0.62 μM, K_d = 804 nM). ALKBH5-IN-5 disrupts ALKBH5 binding to m ⁶A-RNA and 6mA-DNA substrates. ALKBH5-IN-5 promotes differentiation, induces apoptosis, cause G2-M phase arrest and exerts strong antiproliferative effects in cancer cells. ALKBH5-IN-5 reduces TACC3 and MYC protein levels and increases cleaved caspase-3 levels. ALKBH5-IN-5 exerts antitumor activity in tumor xenograft mice models. ALKBH5-IN-5 can be used for the research of acute myeloid leukemia .

HY-124648

SMN-C2	DNA/RNA Synthesis	Inflammation/Immunology
SMN-C2, an analog of RG-7916, is a selective modulator of SMN2 gene splicing that acts by binding SMN2 pre-mRNA, thereby increasing far upstream element binding protein 1 (FUBP1) and KH-spliced RNA binding Protein affinity regulator protein (KHSRP) to the SMN2 pre-mRNA complex. SMN-C2 can be used in spinal muscular atrophy (SMA) research .

HY-124806

TTP-8307 2 Publications Verification	Enterovirus DNA/RNA Synthesis HCV	Infection
TTP-8307 is a potent inhibitor of the replication of several rhino- and enteroviruses. TTP-8307 inhibits coxsackievirus B3 (CVB3; EC₅₀=1.2 μM) and poliovirus by interfering with the synthesis of viral RNA. TTP-8307 exerts antiviral activity through oxysterol-binding protein (OSBP) .

HY-B0220S1

Erythromycin-13C,d3	Isotope-Labeled Compounds Bacterial Antibiotic	Infection
Erythromycin- ¹³C,d₃ is the ¹³C- and deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete?Streptomyces erythreus?with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits?RNA-dependent protein synthesis?by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid .

HY-153843

RNA Aptamer Corn sodium	Biochemical Assay Reagents	Others
RNA Aptamer Corn (sodium) is a 28-nt-long aptamer that is substantially shorter than Spinach and Spinach2 and exhibits bright red fluorescence upon binding DFHO (a soluble analog of the intrinsic fluorophore of red fluorescent protein), RNA Aptamer Corn (sodium) can be used to visualize RNA expression or localization in live cells which have been soaked with chromophores. The Corn-DFHO does not become appreciably cytotoxic when illuminated. And most importantly, Corn-DFHO exhibits markedly increased photostability compared to other aptamer-chromophore complexes both in vitro and in vivo. (36 nt Corn construct: 5'-GGCGCGAGGAAGGAGGUCUGAGGAGGUCACUGCGCC-3'; A 36-nt RNA construct, comprised of the 28-nt minimal Corn sequence extended proximally with a 4 base-pair stem.)

HY-148062

RSS0680	PROTACs CDK AAK1 Cyclin G-associated Kinase (GAK) Salt-inducible Kinase (SIK) LIM Kinase (LIMK) Wee1 SnRK	Others
RSS0680 is a small noncoding RNA (sRNA) targeting the mRNA ribosome binding site (RBS) and a PROTAC with protein kinase degradation activity (Pink: FLT3-IN-17 (HY-148070); Black: Linker (HY-W041970); Blue: E3 ligase Ligand (HY-112078)). RSS0680 competitively binds to RBS through the conserved CCUCCUCCC anti-Shine-Dalgarno (aSD) sequence and inhibits the translation initiation of target genes. RSS0680 can interact with the DUF1127 protein CcaF1, regulate its own stability and participate in bacterial oxidative stress defense, enhancing the host's resistance to heat shock and oxidative damage by affecting pathways such as C1 metabolism and pyruvate dehydrogenase complex. RSS0680 degrades AAK1, CDK1, CDK16, CDK2, CDK4, CDK6, EIF2AK4, GAK, LATSl, LIMK2, MAPK6, MAPKAPK5, MARK2, MARK4, MKNK2, NEK9, RPS6KB1, SIK2, SNRK, STK17A, STK17B, STK35, and WEEl. RSS0680 can be used to study diseases or disorders mediated by aberrant kinase activity and regulatory mechanisms of noncoding RNAs in α-proteobacteria[1][2].

HY-141878

di-Ellipticine-RIBOTAC	RIBOTAC DNA/RNA Synthesis	Neurological Disease
di-Ellipticine-RIBOTAC is a RNase recruiting chimera (RIBOTAC) degrader, capable of specifically binding and degrading *expanded G4C2 RNA* repeat (r(G₄C₂) ^exp)*. di-Ellipticine-RIBOTAC selectively binds* the three-dimensional (3D) structure formed by r(G₄C₂) ^exp and that recruits an endogenous ribonuclease (RNase) to cleave r(G₄C₂) ^exp. di-Ellipticine-RIBOTAC selectively degrades the mutant chromosome 9 open reading frame 72 (C9orf72) allele and reduces quantities of toxic dipeptide repeat proteins (DPRs) translated from r(G₄C₂) ^exp. di-Ellipticine-RIBOTAC significantly improves the pathological phenotype of amyotrophic lateral sclerosis/ frontotemporal dementia (c9ALS/FTD) in cells and mouse models. di-Ellipticine-RIBOTAC can be used for the study of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) .

HY-138652

L-Histidine benzyl ester bistosylate	Bacterial	Others
L-Histidine benzyl ester bistosylate could play a role in the activation of HutP (an RNA-binding protein) .

HY-119734

Gossypolone	DNA/RNA Synthesis	Cancer
Gossypolone is an RNA-binding protein Musashi-1 inhibitor with a K_i of 12 nM. Gossypolone disrupts the Musashi-numb RNA interaction and directly binds to the RBD1 of MSI1 protein. Gossypolone can be used for the research of cancer .

HY-175397

Dth DFHBI-thalidomide	PROTACs NF-κB Early 2 Factor (E2F) Bcl-2 Family VEGFR	Cancer
Dth (DFHBI-thalidomide) is an RNA aptamer-based PROTAC degrader. Dth can degrade a variety of endogenous proteins (such as mCherry, p50, p65 and E2F1) by replacing the 3′ module on the RNA scaffold with the RNA aptamer corresponding to the target protein. Dth upregulates IκB-α and Bax, and downregulates Bcl-2 and VEGF. Dth generates green fluorescence upon binding to the Broccoli RNA aptamer, enabling the tracing of RNA scaffolds. Dth can be used in cancer-related research .

HY-125972

zr17-2	Keap1-Nrf2 Heme Oxygenase (HO)	Cardiovascular Disease Neurological Disease
zr17-2 is a *cold inducible RNA-binding* protein (CIRBP)** agonist. zr17-2 has anti-inflammatory and anti-oxidant and can be used for the study of myocardial infarction. zr17-2 is a hypothermia mimetic molecule that reduces oxidative stress-induced retinal cell death .

HY-B0275S

Oxytetracycline-d6	Isotope-Labeled Compounds Antibiotic Bacterial Endogenous Metabolite HSV	Infection
Oxytetracycline-d₆ is deuterium labeled Oxytetracycline. Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-112591

NSC260594 XMH95	Apoptosis HIV Wnt Bcl-2 Family	Cancer
NSC260594 induces Apoptosis. NSC260594 binds the shallow groove of the Mcl-1 protein, and inhibits Mcl-1 expression through down-regulation of Wnt signaling proteins. NSC260594 can also recognize G9-G10-A11-G12 RNA tetraloop of HIV and prevent the binding of the Gag protein within the 5’-UTR. NSC260594 inhibits tumor growth, and can be used for research of Triple-negative breast cancers (TNBCs) .

HY-139098

7-Methyl-diguanosine triphosphate m7Gp3G	DNA/RNA Synthesis	Others
7-Methyl-diguanosine triphosphate (m7Gp3G) is an mRNA cap structure analog that inhibits in vitro protein synthesis by binding to the translation initiation complex. 7-Methyl-diguanosine triphosphate binds to eIF4E, promotes cap-dependent translation initiation, stabilizes mRNA, and acts as a translation enhancer. 7-Methyl-diguanosine triphosphate can be used to prepare synthetic capped RNA transcripts for studies related to mRNA translation, splicing, turnover, and intracellular transport .

HY-113225S2

Guanosine triphosphate-13C dilithium GTP-13C dilithium	Isotope-Labeled Compounds Endogenous Metabolite Mitosis Apoptosis DNA/RNA Synthesis	Infection Cancer
Guanosine triphosphate- ¹³C (GTP- ¹³C) dilithium is ¹³C-labeled Guanosine triphosphate (HY-113225). Guanosine triphosphate (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-113225S3

Guanosine triphosphate-15N5 dilithium GTP-15N5 dilithium	Isotope-Labeled Compounds Endogenous Metabolite Mitosis Apoptosis DNA/RNA Synthesis	Infection Cancer
Guanosine triphosphate- ¹⁵N₅ (GTP- ¹⁵N₅) dilithium is ¹⁵N labeled Guanosine triphosphate (HY-113225). Guanosine triphosphate dilithium (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate dilithium promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate dilithium links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate dilithium accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate dilithium is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-113225S5

Guanosine triphosphate-13C10 dilithium GTP-¹³C₁₀ dilithium	Isotope-Labeled Compounds Endogenous Metabolite Mitosis Apoptosis DNA/RNA Synthesis	Infection Cancer
Guanosine triphosphate- ¹³C₁₀ (GTP- ¹³C₁₀) dilithium is ¹³C-labeled Guanosine triphosphate (HY-113225). Guanosine triphosphate dilithium (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate dilithium promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate dilithium links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate dilithium accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate dilithium is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-124844

Azaphilone-9 AZA-9	HuR	Cancer
Azaphilone-9 (AZA-9) is an inhibitor of HuR-ARE RNA interaction (IC₅₀=1.2 μM) by binding RNA-binding protein Hu antigen R (HuR). The HuR-RNA interactions stabilize many oncogenic mRNAs in tumors. Thus Azaphilone-9 potentially inhibit cancer cell growth and progression .

HY-177454

Basivarsen linker	ADC Linker	Others
Basivarsen linker is a linker used in HY-177452 Zeleciment basivarsen for coupling a TfR1-binding Fab (HY-P990780 Zeleciment) and an antisense oligonucleotide. Zeleciment basivarsen is an antibody-oligonucleotide conjugate (AOC) designed to target mutant nuclear myotonic dystrophy protein kinase (DMPK) RNA for RHase H-mediated degradation to correct splicing. It is used for the study of myotonic dystrophy type 1 (DM1).

HY-B0275S1

Oxytetracycline-d3	Isotope-Labeled Compounds Endogenous Metabolite Bacterial Antibiotic HSV	Infection
Oxytetracycline-d₃ is the deuterium labeled Oxytetracycline (HY-B0275). Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-122903S

TK216-d4	Isotope-Labeled Compounds DNA/RNA Synthesis	Cancer
TK216-d₄ is the deuterium labeled TK216 (HY-122903). TK216 is an orally active and potent E26 transformation specific (ETS) inhibitor . TK216 directly binds EWS-FLI1 and inhibits EWS-FLI1 protein interactions. TK216 blocks the binding between EWS-FLI1 and RNA helicase A. TK216 has anticancer activity .

Cat. No.	Product Name

HY-L158

Highly Selective Inhibitors Library

6,135 compounds

According to reports, most known kinase inhibitors exert their effects through competitive binding in highly conserved ATP pockets. Although genetic techniques such as RNA interference can inactivate specific genes, most kinases are multi domain proteins, each of which has an independent function. Highly selective inhibitors have higher efficiency than non-selective inhibitors, and the selectivity to the target is at least 100 times higher. Therefore, ensuring the validation of targets with the most selective inhibitors is crucial for a more thorough understanding of the pharmacology of the kinase field. The Highly Selective Inhibitors Library contains 6,135 compounds, covering multiple targets and subtypes, such as GPCR protein family, Ion channel, multiple kinases, etc. The Highly Selective Inhibitors Library is an effective tool for screening different phenotypes

Cat. No.	Product Name	Type

HY-130777A

AMP-PNP lithium hydrate

3 Publications Verification

Adenylyl imidodiphosphate lithium hydrate

Biochemical Assay Reagents

AMP-PNP (Adenylyl imidodiphosphate) lithium hydrate is a non-hydrolyzable ATP analog. AMP-PNP lithium hydrate binds to ATP binding sites competely but is not hydrolyzed by enzymes, providing stable experimental conditions for studying ATP-dependent processes. AMP-PNP lithium hydrate can also be used to study enzyme activity, kinase regulation, DNA/RNA metabolism, ion channel function, and protein complex assembly .

HY-153235

COVID-19 Spike Protein mRNA-LNP

Biochemical Assay Reagents

COVID-19 Spike Protein mRNA-LNP is a lipid nanoparticle (LNP) containing mRNA encoding COVID-19 Spike Protein. COVID-19 Spike Protein undertakes the functions of virus binding with host cell receptors, thereby mediating the entry of COVID-19 virus into cells. COVID-19 Spike Protein is an important site of action for host neutralizing antibodies and a key target for vaccine design. COVID-19 Spike Protein mRNA-LNP can be used for RNA delivery, vaccine formulation and design targeting SARS-CoV-2 .

HY-139098

7-Methyl-diguanosine triphosphate

m7Gp3G

Biochemical Assay Reagents

7-Methyl-diguanosine triphosphate (m7Gp3G) is an mRNA cap structure analog that inhibits in vitro protein synthesis by binding to the translation initiation complex. 7-Methyl-diguanosine triphosphate binds to eIF4E, promotes cap-dependent translation initiation, stabilizes mRNA, and acts as a translation enhancer. 7-Methyl-diguanosine triphosphate can be used to prepare synthetic capped RNA transcripts for studies related to mRNA translation, splicing, turnover, and intracellular transport .

HY-139098A

7-Methyl-diguanosine triphosphate ammonium

m7Gp3G ammonium

Biochemical Assay Reagents

7-Methyl-diguanosine triphosphate (m7Gp3G) ammonium is an mRNA cap structure analog that inhibits in vitro protein synthesis by binding to the translation initiation complex. 7-Methyl-diguanosine triphosphate ammonium binds to eIF4E, promotes cap-dependent translation initiation, stabilizes mRNA, and acts as a translation enhancer. 7-Methyl-diguanosine triphosphate ammonium can be used to prepare synthetic capped RNA transcripts for studies related to mRNA translation, splicing, turnover, and intracellular transport .

Cat. No.	Product Name	Target	Research Area

HY-P5117

TAT-CIRP	Toll-like Receptor (TLR)	Neurological Disease
TAT-CIRP is a a small peptide, refers to Trans-trans-activating (Tat)-cold-inducible RNA binding protein. TAT-CIRP is an inhibitor of *myeloid differentiation protein* 2 (MD2**). TAT-CIRP exhibits robust neuroprotection against ischemic and hemorrhagic stroke in mice .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-B0275

Oxytetracycline Maximum Cited Publications 10 Publications Verification	Structural Classification Classification of Application Fields Antibacterial Disease Research Endogenous metabolite Other Antibiotics Plant agriculture research Infection Monophenols Microorganisms Antibiotics Resistance Selection Animal Husbandry Phenols Disease Research Fields Source Classification	Environmental Pollutants Antibiotic Endogenous Metabolite Bacterial HSV
Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-B0275A

Oxytetracycline hydrochloride Maximum Cited Publications 10 Publications Verification	Structural Classification Classification of Application Fields Antibacterial Disease Research Endogenous metabolite Other Antibiotics Infection Monophenols Microorganisms Antibiotics Phenols Disease Research Fields Source Classification	Environmental Pollutants Antibiotic Endogenous Metabolite Bacterial HSV
Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-B0275B

Oxytetracycline dihydrate Maximum Cited Publications 10 Publications Verification	Infection Monophenols Microorganisms Classification of Application Fields Antibiotics Phenols Antibacterial Disease Research Endogenous metabolite Disease Research Fields Other Antibiotics Source Classification	Bacterial HSV Antibiotic Endogenous Metabolite
Oxytetracycline dihydrate is an antibiotic belonging to the tetracycline class. Oxytetracycline dihydrate potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline dihydrate is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline dihydrate also possesses anti-HSV-1 activity .

HY-113225

Guanosine triphosphate GTP	Infection Structural Classification Natural Products Human Gut Microbiota Metabolites Microorganisms Classification of Application Fields Endogenous metabolite Disease Research Fields Source Classification Cancer	Endogenous Metabolite DNA/RNA Synthesis Apoptosis Mitosis
Guanosine triphosphate (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-B0275AR

Oxytetracycline hydrochloride (Standard)	Structural Classification Monophenols Microorganisms Antibiotics Phenols Antibacterial Disease Research Endogenous metabolite Other Antibiotics Source Classification	Reference Standards Bacterial HSV Antibiotic Endogenous Metabolite
Oxytetracycline (hydrochloride) (Standard) is the analytical standard of Oxytetracycline (hydrochloride). This product is intended for research and analytical applications. Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-101112

Okicenone	Structural Classification Microorganisms Phenols Polyphenols Source Classification	HuR
Okicenone is a Hu protein R (HuR) inhibitor. Okicenone inhibits HuR oligomerization, interferes with HuR RNA binding, HuR trafficking, cytokine expression and T-cell activation .

HY-B0275C

Oxytetracycline calcium	Infection Quinones Classification of Application Fields Anthraquinones Endogenous metabolite Disease Research Fields Source Classification	Bacterial HSV Antibiotic Endogenous Metabolite
Oxytetracycline calcium is an antibiotic belonging to the tetracycline class. Oxytetracycline calcium potently inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline calcium is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline calcium also possesses anti-HSV-1 activity .

HY-B0275R

Oxytetracycline (Standard)	Structural Classification Antibacterial Disease Research Endogenous metabolite Other Antibiotics Plant agriculture research Monophenols Microorganisms Antibiotics Resistance Selection Animal Husbandry Phenols Source Classification	Reference Standards Bacterial HSV Endogenous Metabolite Antibiotic
Oxytetracycline (Standard) is the analytical standard of Oxytetracycline. This product is intended for research and analytical applications. Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-N14366

Fleephilone	Natural Products Microorganisms Source Classification	HIV Endogenous Metabolite
Fleephilone is a fungal metabolite that can be isolated from Trichoderma harzianum. Fleephilone is a HIV REV/RRE binding inhibitor. Fleephilone inhibits the binding of REV-protein to RRE RNA with an IC₅₀ of 7.6 μM .

HY-B0275BR

Oxytetracycline dihydrate (Standard)	Structural Classification Monophenols Microorganisms Antibiotics Phenols Antibacterial Disease Research Endogenous metabolite Other Antibiotics Source Classification	Reference Standards Bacterial HSV Antibiotic Endogenous Metabolite
Oxytetracycline (dihydrate) (Standard) is the analytical standard of Oxytetracycline (dihydrate). This product is intended for research and analytical applications. Oxytetracycline dihydrate is an antibiotic belonging to the tetracycline class. Oxytetracycline dihydrate potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline dihydrate is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline dihydrate also possesses anti-HSV-1 activity .

Species:	Human (12) Virus (14) Mouse (2)
Tag:	SUMO (2) His (19) Strep (2) Tag Free (10) Avi (1) Myc (1) MBP (1) Flag (1)
Source:	HEK293 (1) Sf9 insect cells (2) P. pastoris (1) E. coli (25)

Cat. No.	Compare	Product Name	Species	Source	Image

HY-P75559

	acnB Protein, E. coli Aconitate hydratase B; ACN; Aconitase; RNA-binding protein; acnB; yacI; yacJ	Virus	E. coli
	The acnB protein coordinates short-chain fatty acid catabolism through the TCA pathway and 2-methylcitric acid cycle I, demonstrating catalytic versatility. It is involved in the reversible isomerization of citric acid to isocitrate and the hydration of 2-methyl-cis-aconitic acid. acnB Protein, E. coli is the recombinant Virus-derived acnB protein, expressed by E. coli , with tag free.

HY-P72145

	CIRBP Protein, Mouse (His) 1 Publications Verification Cirbp; CirpCold-inducible RNA-binding protein; A18 hnRNP; Glycine-rich RNA-binding protein CIRP	Mouse	E. coli
	CIRBP protein, a key player in cellular response to genotoxic stress, stabilizes survival-associated transcripts. It aids stress granule assembly, suppresses cell proliferation in the cold, and regulates translation. CIRBP interacts with EIF4G1, associates with ribosomes, and targets the 3'-UTRs of stress-responsive transcripts like RPA2 and TXN. It contributes to intricate molecular regulatory mechanisms. CIRBP Protein, Mouse (His) is the recombinant mouse-derived CIRBP protein, expressed by E. coli , with N-6*His labeled tag.

HY-P705425

	CIRBP Protein, Mouse (C-His) Cirbp; CirpCold-inducible RNA-binding protein; A18 hnRNP; Glycine-rich RNA-binding protein CIRP	Mouse	E. coli

HY-P703385

	MSI2 Protein, Human (His, Strep) RNA-binding protein Musashi homolog 2; MSI2; Homo sapiens; Human; Musashi-2; RNA-binding	Human	E. coli
	MSI2 Protein, Human (His, Strep) is the recombinant human-derived MSI2, expressed by E. coli , with Strep, His labeled tag. ,

HY-P702824

	PNO1 Protein, Human (His) RNA-binding protein PNO1; Partner of NOB1	Human	E. coli
	PNO1 Protein, Human (His) is the recombinant human-derived PNO1, expressed by E. coli , with C-6*His labeled tag.

HY-P76261

	CIRBP Protein, Human (His) 1 Publications Verification Cold-inducible RNA-binding protein A; XCIRP; cirbp-a; CIRP-1	Human	E. coli
	CIRBP is a cold-induced mRNA-binding protein that plays a key role in cellular responses to genotoxic stress, exerting a protective effect by stabilizing transcripts of genes critical for cell survival. As a translation activator, CIRBP appears to be critical for cold-induced inhibition of cell proliferation. CIRBP Protein, Human (His) is the recombinant human-derived CIRBP protein, expressed by E. coli , with N-His labeled tag.

HY-P71612

	RBM14 Protein, Human (His-SUMO) RBM14; SIP; RNA-binding protein 14; Paraspeckle protein 2; PSP2; RNA-binding motif protein 14; RRM-containing coactivator activator/modulator; Synaptotagmin-interacting protein; SYT-interacting protein	Human	E. coli
	The RBM14 protein has different isoforms with multiple functions. Isoform 1 enhances transcription as a nuclear receptor coactivator, interacting with NCOA6 and CITED1. RBM14 Protein, Human (His-SUMO) is the recombinant human-derived RBM14 protein, expressed by E. coli , with N-SUMO, N-6*His labeled tag.

HY-P702591

	PTBP1 Protein, Human (HEK293, His) Polypyrimidine tract-binding protein 1; PTB; 57 kDa RNA-binding protein PPTB-1; Heterogeneous nuclear ribonucleoprotein I (hnRNP I)	Human	HEK293
	PTBP1 Protein, Human (HEK293, His) is the recombinant human-derived PTBP1, expressed by HEK293 , with N-10*His labeled tag. ,

HY-P705436

	TIA1 Protein, Human (His) Nucleolysin TIA-1 isoform p40 Curated; RNA-binding protein TIA-1; T-cell-restricted intracellular antigen-1 (TIA-1); p40-TIA-1; Cytotoxic granule associated RNA binding protein TIA1; TIA1	Human	E. coli

HY-P71819

	ELAVL3 Protein, Human (P.pastoris, His) ELAV like 3; ELAV like 4; ELAV like neuron specific RNA binding protein 3; ELAV like neuron specific RNA binding protein 4; ELAV like protein 3; ELAV like protein 4; ELAV-like protein 3; PLE21; PNEM	Human	P. pastoris
	ELAVL3 protein is an RNA-binding protein that specifically binds to the ARE sequence in target mRNA, including VEGF. It may also interact with polyA tracts through its RRM3. ELAVL3 Protein, Human (P.pastoris, His) is the recombinant human-derived ELAVL3 protein, expressed by P. pastoris , with N-His labeled tag.

HY-P702630

	FUS Protein, Human (His, Myc) RNA-binding protein FUS; 75 kDa DNA-pairing protein; Oncogene FUS; Oncogene TLS; POMp75; Translocated in liposarcoma protein; TLS	Human	E. coli
	FUS Protein, Human (His, Myc) is the recombinant human-derived FUS, expressed by E. coli , with N-10*His, C-Myc labeled tag.

HY-P704622

	FUS Protein, Human (MBP-His) RNA-binding protein FUS; 75 kDa DNA-pairing protein; Oncogene FUS; Oncogene TLS; POMp75; Translocated in liposarcoma protein; TLS	Human	E. coli
	FUS Protein, Human (MBP-His) is the recombinant human-derived FUS protein, expressed by E. coli, with N-His & N-MBP tag.

HY-P705480

	FXR1 Protein, Human (His) RNA-binding protein FXR1; FMR1 autosomal homolog 1; hFXR1p; FXR1	Human	E. coli

HY-P705997

	LRRFIP1 Protein, Human LRRFIP1; Leucine-rich repeat flightless-interacting protein 1; LRR FLII-interacting protein 1; GC-binding factor 2; TAR RNA-interacting protein	Human	E. coli
	LRRFIP1 is a transcriptional repressor that preferentially binds to GC-rich sequences (5'-AGCCCCCGGCG-3') and may regulate the expression of TNF, EGFR, and PDGFA. It inhibits PDGFA, which controls smooth muscle cell proliferation after arterial injury. LRRFIP1 Protein, Human is the recombinant human-derived LRRFIP1 protein, expressed by E. coli.

HY-P703547

	HCVNS5B Protein, HCV Genome polyprotein; Hepatitis C virus genotype 1b (strain HC-J4); HCV; p23; Helicase; Hydrolase; Ion channel; Multifunctional enzyme; Nucleotidyltransferase; Protease; Ribonucleoprotein; RNA-binding; RNA-directed RNA polymerase; Serine protease; Thiol protease; Transferase; Viral ion channel; Viral nucleoprotein	Others	E. coli
	POLG proteins play multiple roles in the viral life cycle, contributing to viral RNA packaging, budding, and particle production. It exhibits RNA-binding and RNA chaperone activities, affecting translation initiation through interactions with viral IRES and ribosomal subunits. HCVNS5B Protein, HCV is the recombinant HCVNS5B, expressed by E. coli, with tag-free.

HY-P703532

	SARS-CoV-2 NSP16-NSP10 Protein Replicase polyprotein 1ab; ORF1ab polyprotein; rep; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1ab; Endonuclease; Exonuclease; Helicase; Hydrolase; Lyase; Methyltransferase; Nuclease Nucleotidyltransferase; Protease; RNA-binding; RNA-directed RNA polymerase; Thiol protease; Transferase;	Virus	E. coli
	The multifunctional SARS-CoV-2 PP1ab protein is essential for viral RNA transcription and replication, utilizing proteases for multi-protein cleavage. It inhibits host translation by binding to the 40S subunit and blocks ribosomal mRNA entry channels, thereby hindering the antiviral response. NSP16/NSP10 Protein, SARS-CoV-2 is the recombinant virus-derived NSP16/NSP10, expressed by E. coli, with tag-free.

HY-P703533

	SARS-CoV-2 NSP16-NSP10 Protein (His) Replicase polyprotein 1ab; ORF1ab polyprotein; rep; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1ab; Endonuclease; Exonuclease; Helicase; Hydrolase; Lyase; Methyltransferase; Nuclease Nucleotidyltransferase; Protease; RNA-binding; RNA-directed RNA polymerase; Thiol protease; Transferase;	Virus	E. coli
	The multifunctional SARS-CoV-2 PP1ab protein is essential for viral RNA transcription and replication, utilizing proteases for multi-protein cleavage. It inhibits host translation by binding to the 40S subunit and blocks ribosomal mRNA entry channels, thereby hindering the antiviral response. NSP16/NSP10 Protein, Severe acute respiratory syndrome coronavirus 2 (2019-nCoV) (SARS-CoV-2) (His) is the recombinant virus-derived NSP16/NSP10, expressed by E. coli, with His labeled tag.

HY-P703543

	SARS-CoV-2 RdRP Protein (sf9, His, Strep) Replicase polyprotein 1ab; ORF1ab polyprotein; rep; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1ab; Endonuclease; Exonuclease; Helicase; Hydrolase; Lyase; Methyltransferase; Nuclease Nucleotidyltransferase; Protease; RNA-binding; RNA-directed RNA polymerase; Thiol protease; Transferase;	Virus	Sf9 insect cells
	The multifunctional SARS-CoV-2 PP1ab protein is essential for viral RNA transcription and replication, utilizing proteases for multi-protein cleavage. It inhibits host translation by binding to the 40S subunit and blocks ribosomal mRNA entry channels, thereby hindering the antiviral response. RdRP Protein, Severe acute respiratory syndrome coronavirus 2 (2019-nCoV) (SARS-CoV-2) (Sf9, His, Strep) is the recombinant virus-derived RdRP, expressed by Sf9 insect cells, with Strep, His labeled tag.

HY-P703529

	SARS-CoV-2 NCP N Protein (101a.a) Nucleoprotein; Nucleocapsid protein; NC; protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; Viral nucleoprotein	Virus	E. coli
	The SARS-CoV-2 nucleocapsid protein plays a crucial role in assembling the virion, forming the helical ribonucleocapsid (RNP), and interacting with the viral genome and membrane protein M. In addition to its structural function, it also enhances subgenomic viral RNA transcription and overall replication. NCP N Protein, SARS-CoV-2 (N269-K369) is the recombinant virus-derived NCP N, expressed by E. coli, with tag-free.

HY-P703530

	SARS-CoV-2 NCP N Protein (126a.a) Nucleoprotein; Nucleocapsid protein; NC; protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; Viral nucleoprotein	Virus	E. coli
	The SARS-CoV-2 nucleocapsid protein plays a crucial role in assembling the virion, forming the helical ribonucleocapsid (RNP), and interacting with the viral genome and membrane protein M. In addition to its structural function, it also enhances subgenomic viral RNA transcription and overall replication. NCP N Protein, SARS-CoV-2 (N48-A173) is the recombinant virus-derived NCP N, expressed by E. coli, with tag-free.

HY-P703531

	SARS-CoV-2 NCP N Protein (sf9, His, Flag) Nucleoprotein; Nucleocapsid protein; NC; protein N; N; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; N; Ribonucleoprotein; RNA-binding; Viral nucleoprotein	Virus	Sf9 insect cells
	The SARS-CoV-2 nucleocapsid protein plays a crucial role in assembling the virion, forming the helical ribonucleocapsid (RNP), and interacting with the viral genome and membrane protein M. In addition to its structural function, it also enhances subgenomic viral RNA transcription and overall replication. NCP N Protein, SARS-CoV-2 (Sf9, His, Flag) is the recombinant virus-derived NCP N, expressed by Sf9 insect cells, with His, Flag labeled tag.

HY-P703548

	pp1a Protein, AIBV (His) Replicase polyprotein 1a; ORF1a polyprotein; Avian infectious bronchitis virus (strain M41); IBV; pp1a; Hydrolase; Lyase; Protease; RNA-binding; Thiol protease	Virus	E. coli
	pp1a Protein, AIBV (His) is the recombinant virus-derived pp1a protein, expressed by E. coli, with His tag.

HY-P703536

	SARS-CoV-2 NSP3 Protein (His) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli
	The multifunctional PL-PRO protein plays a critical role in viral RNA transcription and replication, providing the necessary proteases for multiprotein cleavage. It strategically blocks host translation by binding to the open head conformation of the 40S subunit, impeding ribosomal mRNA entry into the tunnel. NSP3 Protein, SARS-CoV-2 (His) is the recombinant virus-derived NSP3, expressed by E. coli, with N-His labeled tag.

HY-P703539

	SARS-CoV-2 NSP7 Protein (His-Avi) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli
	The multifunctional PL-PRO protein plays a critical role in viral RNA transcription and replication, providing the necessary proteases for multiprotein cleavage. It strategically blocks host translation by binding to the open head conformation of the 40S subunit, impeding ribosomal mRNA entry into the tunnel. SARS-CoV-2 NSP7 Protein (His-Avi) is the recombinant virus-derived NSP7, expressed by E. coli, with C-His-Avi labeled tag.

HY-P703534

	SARS-CoV-2 NSP3 Protein (372a.a) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli
	The multifunctional PL-PRO protein plays a critical role in viral RNA transcription and replication, providing the necessary proteases for multiprotein cleavage. It strategically blocks host translation by binding to the open head conformation of the 40S subunit, impeding ribosomal mRNA entry into the tunnel. NSP3 Protein, SARS-CoV-2 (A1-F372) is the recombinant virus-derived NSP3, expressed by E. coli, with tag-free.

HY-P703535

	SARS-CoV-2 NSP3 Protein (183a.a) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli
	The multifunctional PL-PRO protein plays a critical role in viral RNA transcription and replication, providing the necessary proteases for multiprotein cleavage. It strategically blocks host translation by binding to the open head conformation of the 40S subunit, impeding ribosomal mRNA entry into the tunnel. NSP3 Protein, SARS-CoV-2 (A1-T183) is the recombinant virus-derived NSP3, expressed by E. coli, with tag-free.

HY-P703537

	SARS-CoV-2 NSP3 Protein (357a.a) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli
	The multifunctional PL-PRO protein plays a critical role in viral RNA transcription and replication, providing the necessary proteases for multiprotein cleavage. It strategically blocks host translation by binding to the open head conformation of the 40S subunit, impeding ribosomal mRNA entry into the tunnel. NSP3 Protein, SARS-CoV-2 (I388-R745) is the recombinant virus-derived NSP3, expressed by E. coli, with tag-free.

HY-P703538

	SARS-CoV-2 NSP3 Protein (338a.a) Replicase polyprotein 1a; ORF1a polyprotein; Severe acute respiratory syndrome coronavirus 2; 2019-nCoV; pp1a; Endonuclease; Hydrolase; Methyltransferase; Nuclease; Protease; RNA-binding; Thiol protease; Transferase	Virus	E. coli
	The multifunctional PL-PRO protein plays a critical role in viral RNA transcription and replication, providing the necessary proteases for multiprotein cleavage. It strategically blocks host translation by binding to the open head conformation of the 40S subunit, impeding ribosomal mRNA entry into the tunnel. NSP3 Protein, SARS-CoV-2 (E746-K1083) is the recombinant virus-derived NSP3, expressed by E. coli, with tag-free.

HY-P700506

	EIF3G Protein, Human (His-SUMO) eukaryotic translation initiation factor 3 subunit G; EIF3S4; EIF3-P42; eIF3-p44; eIF3-delta; eukaryotic translation initiation factor 3 subunit G; eukaryotic translation initiation factor 3 RNA-binding subunit; eukaryotic translation initiation factor 3 subunit p42; eukaryotic translation initiation factor 3, subunit 4 delta, 44kDa	Human	E. coli
	The EIF3G protein is an RNA-binding component of the eIF-3 complex that initiates protein synthesis by promoting the recruitment of factors to form the 43S PIC. EIF3G is critical in both mRNA recruitment and AUG recognition scanning. EIF3G Protein, Human (His-SUMO) is the recombinant human-derived EIF3G protein, expressed by E. coli , with N-SUMO, N-6*His labeled tag.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name	Chemical Structure

HY-B0220S1

Erythromycin-13C,d3

Erythromycin- ¹³C,d₃ is the ¹³C- and deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete?Streptomyces erythreus?with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits?RNA-dependent protein synthesis?by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid .

HY-B0275S

Oxytetracycline-d6
Oxytetracycline-d₆ is deuterium labeled Oxytetracycline. Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-113225S2

Guanosine triphosphate-13C dilithium

Guanosine triphosphate- ¹³C (GTP- ¹³C) dilithium is ¹³C-labeled Guanosine triphosphate (HY-113225). Guanosine triphosphate (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-113225S3

Guanosine triphosphate-15N5 dilithium

Guanosine triphosphate- ¹⁵N₅ (GTP- ¹⁵N₅) dilithium is ¹⁵N labeled Guanosine triphosphate (HY-113225). Guanosine triphosphate dilithium (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate dilithium promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate dilithium links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate dilithium accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate dilithium is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-113225S5

Guanosine triphosphate-13C10 dilithium

Guanosine triphosphate- ¹³C₁₀ (GTP- ¹³C₁₀) dilithium is ¹³C-labeled Guanosine triphosphate (HY-113225). Guanosine triphosphate dilithium (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate dilithium promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate dilithium links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate dilithium accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate dilithium is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-B0275S1

Oxytetracycline-d3

Oxytetracycline-d₃ is the deuterium labeled Oxytetracycline (HY-B0275). Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity .

HY-122903S

TK216-d4
TK216-d₄ is the deuterium labeled TK216 (HY-122903). TK216 is an orally active and potent E26 transformation specific (ETS) inhibitor . TK216 directly binds EWS-FLI1 and inhibits EWS-FLI1 protein interactions. TK216 blocks the binding between EWS-FLI1 and RNA helicase A. TK216 has anticancer activity .

HY-W755036

Oxytetracycline-13C,d3 hydrochloride

Oxytetracycline-13C,d3 hydrochloride is the 13C- and deuterium labeled Oxytetracycline hydrochloride (HY-B0275A). Oxytetracycline hydrochloride is an antibiotic that exhibits board-spectrum antibacterial activity. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity .

HY-113225S1

Guanosine triphosphate-13C10,15N5 tetraammonium solution (100 mM)

Guanosine triphosphate- ¹³C₁₀, ¹⁵N₅ tetraammonium is the ¹³C and ¹⁵N labeled Guanosine triphosphate tetraammonium. Guanosine triphosphate tetraammonium (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate tetraammonium promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate tetraammonium links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate tetraammonium accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate tetraammonium is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-B0268S1

Enoxacin-d8 hydrochloride

Enoxacin-d₈ (hydrochloride) is deuterium labeled Enoxacin. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC₅₀=126 μg/ml) and topoisomerase IV (IC₅₀=26.5 μg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .

HY-113225S4

Guanosine triphosphate-15N5,d14 dilithium

Guanosine triphosphate- ¹⁵N₅,d₁₄ (GTP- ¹⁵N₅,d₁₄) dilithium is deuterium and ¹⁵N labeled Guanosine triphosphate (HY-113225). Guanosine triphosphate dilithium (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate dilithium promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate dilithium links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate dilithium accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate dilithium is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-14855S

Tedizolid-13C,d3
Tedizolid- ¹³C,d₃ is the ¹³C- and deuterium labeled Tedizolid. Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.

HY-B0220S

Erythromycin-d6

Erythromycin-d₆ is the deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete?Streptomyces erythreus?with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits?RNA-dependent protein synthesis?by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid .

HY-B0268S2

Enoxacin-d8 hydrate

Enoxacin-d₈ (hydrate) is deuterium labeled Enoxacin. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC₅₀=126 μg/ml) and topoisomerase IV (IC₅₀=26.5 μg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing .

Host:	Mouse (9) Rabbit (19)
Reactivity:	Human (26) mouse (1) Rat (14) Mouse (16) Monkey (1)
Application:	WB FC ICC/IF (1) IHC-P (18) ICC/IF (16) IF-Tissue (2) IP (6) IHC-F (7) WB (27) FC (7) ELISA (3)
Isotype:	IgG (19) IgG1 (5) IgG2a (1)
Conjugation:	Non-conjugated (28)
Clonality:	Monoclonal (25) Recombinant (14)
Modification:	Unmodified (25)

Cat. No.	Compare	Product Name	Application	Reactivity	Image

HY-P86263

	RBM43 Antibody (YA5955) RBM43; C2orf38; RNA-binding protein 43 ; RNA-binding motif protein 43;	WB	Human
	RBM43 Antibody (YA5955) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to RBM43.

HY-P86293

	RBMY1A1 Antibody (YA5985) RBMY1A1; RBM1; RBM2; YRRM1; YRRM2; RNA-binding motif protein, Y chromosome, family 1 member A1 ; RNA-binding motif protein 1; RNA-binding motif protein 2; Y chromosome RNA recognition motif 1; hRBMY;	WB, IHC-P	Human
	RBMY1A1 Antibody (YA5985) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to RBMY1A1.

HY-P87300

	Rbm15 Antibody (YA6983) One twenty two protein antibody; One-twenty two protein 1 antibody; OTT antibody; OTT1 antibody; Putative RNA-binding protein 15 antibody; RBM15 antibody; RBM15_HUMAN antibody; RNA binding motif protein 15 antibody; RNA-binding motif protein 15 antibody	WB, IHC-P	Human, Mouse, Rat, Monkey
	Rbm15 Antibody (YA6983) is a Mouse-derived and non-conjugated IgG1 monoclonal antibody, targeting to Rbm15.

HY-P82093

	hnRNP Q Antibody (YA1838) SYNCRIP; HNRPQ; NSAP1; Heterogeneous nuclear ribonucleoprotein Q; hnRNP Q; Glycine- and tyrosine-rich RNA-binding protein; GRY-RBP; NS1-associated protein 1; Synaptotagmin-binding; cytoplasmic RNA-interacting protein	WB, IHC-P, ICC/IF	Human, Mouse, Rat
	hnRNP Q Antibody (YA1838) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to hnRNP Q.

HY-P82472

	PIAS1 Antibody (YA2217) PIAS1; DDXBP1; E3 SUMO-protein ligase PIAS1; DEAD/H box-binding protein 1; Gu-binding protein; GBP; protein inhibitor of activated STAT protein 1; RNA helicase II-binding protein	WB, IHC-P, ICC/IF, FC	Human, Mouse, Rat
	PIAS1 Antibody (YA2217) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to PIAS1.

HY-P85858

	NeuN Antibody (YA5550) RNA binding protein fox-1 homolog 3; Fox-1 homolog C;	WB, IHC-P, ICC/IF, ELISA	Human
	NeuN Antibody (YA5550) is a Mouse-derived and non-conjugated IgG2a monoclonal antibody, targeting to NeuN.

HY-P86090

	NeuN Antibody (YA5782) RNA binding protein fox-1 homolog 3; Fox-1 homolog C;	WB, IHC-P, ICC/IF, IP, ELISA	Human, Mouse, Rat
	NeuN Antibody (YA5782) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to NeuN.

HY-P82389

	TAF15 Antibody (YA2134) TAF15; RBP56; TAF2N; TATA-binding protein-associated factor 2N; 68 kDa TATA-binding protein-associated factor; TAF(II)68; TAFII68; RNA-binding protein 56	WB, IHC-F, IHC-P, ICC/IF	Human, Mouse, Rat
	TAF15 Antibody (YA2134) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to TAF15.

HY-P82389A

	TAF15 Antibody (YA2134)(PBS only) TAF15; RBP56; TAF2N; TATA-binding protein-associated factor 2N; 68 kDa TATA-binding protein-associated factor; TAF(II)68; TAFII68; RNA-binding protein 56	WB, IHC-F, IHC-P, ICC/IF	Human, Mouse, Rat
	TAF15 Antibody (YA2134) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to TAF15.

HY-P82525

	EWSR1 Antibody (YA2270) EWSR1; EWS; RNA-binding protein EWS; EWS oncogene; Ewing sarcoma breakpoint region 1 protein	WB, IHC-P, ICC/IF	Human, Mouse, Rat
	EWSR1 Antibody (YA2270) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to EWSR1.

HY-P83070

	Musashi 1/Msi1 Antibody (YA2815) RNA-binding protein Musashi homolog 1; Musashi-1; MSI1	WB, IHC-P, ICC/IF, IP, FC	Human
	Musashi 1/Msi1 Antibody (YA2815) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to Musashi 1/Msi1.

HY-P83300

	Musashi 2 Antibody (YA3045) MSI2; RNA-binding protein Musashi homolog 2; Musashi-2	WB, IHC-P, ICC/IF, FC	Human, Mouse, Rat
	Musashi 2 Antibody (YA3045) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to Musashi 2.

HY-P85283

	Musashi 1/Msi1 Antibody (YA4975) MSI1; RNA-binding protein Musashi homolog 1; Musashi-1	WB, IHC-P, IHC-F, IF-Tissue, IP, FC, ICC/IF	Human
	Musashi 1/Msi1 Antibody (YA4975) is a Rabbit-derived and non-conjugated monoclonal antibody, targeting to Musashi 1/Msi1.

HY-P85284

	Musashi 2 Antibody (YA4976) MSI2; RNA-binding protein Musashi homolog 2; Musashi-2	WB, IHC-P, IHC-F, ICC/IF, IF-Tissue, FC	Human, Mouse, Rat
	Musashi 2 Antibody (YA4976) is a Rabbit-derived and non-conjugated monoclonal antibody, targeting to Musashi 2.

HY-P87046

	QKI-7 Antibody (YA6739) DKFZp586I0923 antibody; HKQ antibody; Homolog of mouse quaking QKI KH domain RNA binding protein antibody; Hqk antibody; HQK1 antibody; HqkI antibody; OTTHUMP00000017581 antibody; OTTHUMP00000017582 antibody; OTTHUMP00000017583 antibody; protein quaking antibody; DKFZp586I0923 antibody; HKQ antibody; Homolog of mouse quaking QKI KH domain RNA binding protein antibody; Hqk antibody; HQK1 antibody; HqkI antibody; OTTHUMP00000017581 antibody; OTTHUMP00000017582 antibody; OTTHUMP00000017583 antibody; protein quaking antibody; QK antibody; QK1 antibody; QK3 antibody; QKI antibody; QKI_HUMAN antibody; QKI1 antibody; Quaking homolog antibody; Quaking homolog KH domain RNA binding antibody; Quaking homolog KH domain RNA binding mouse antibody; Quaking isoform 1 antibody; Quaking protein antibody; RNA binding protein HQK antibody;	WB	Mouse, Rat
	QKI-7 Antibody (YA6739) is a Mouse-derived and non-conjugated IgG1 monoclonal antibody, targeting to QKI-7.

HY-P85563

	Musashi 1/Msi1 Antibody (YA5255) MSI1; Musashi-1; Msi 1; Msi1; MSI1H_HUMAN; Musashi homolog 1; Musashi-1; Musashi1; RNA binding protein Musashi homolog 1; RNA-binding protein Musashi homolog 1.	WB	Human, Mouse, Rat
	Musashi 1/Msi1 Antibody (YA5255) is a Mouse-derived and non-conjugated monoclonal antibody, targeting to Musashi 1/Msi1.

HY-P87045

	QKI-6 Antibody (YA6738) DKFZp586I0923 antibody; HKQ antibody; Homolog of mouse quaking QKI KH domain RNA binding protein antibody; Hqk antibody; HQK1 antibody; HqkI antibody; OTTHUMP00000017581 antibody; OTTHUMP00000017582 antibody; OTTHUMP00000017583 antibody; protein quaking antibody; DKFZp586I0923 antibody; HKQ antibody; Homolog of mouse quaking QKI KH domain RNA binding protein antibody; Hqk antibody; HQK1 antibody; HqkI antibody; OTTHUMP00000017581 antibody; OTTHUMP00000017582 antibody; OTTHUMP00000017583 antibody; protein quaking antibody; QK antibody; QK1 antibody; QK3 antibody; QKI antibody; QKI_HUMAN antibody; QKI1 antibody; Quaking homolog antibody; Quaking homolog KH domain RNA binding antibody; Quaking homolog KH domain RNA binding mouse antibody; Quaking isoform 1 antibody; Quaking protein antibody; RNA binding protein HQK antibody; QKI-6	WB, IHC-P, IHC-F	Mouse, Rat
	QKI-6 Antibody (YA6738) is a Mouse-derived and non-conjugated IgG1 monoclonal antibody, targeting to QKI-6.

HY-P87378

	RBM15B Antibody (YA7061) 1810017N16Rik antibody; Chromosome 3p21.1 gene sequence antibody; HUMAGCGB antibody; huOTT3 antibody; One twenty two protein 3 antibody; One-twenty two protein 3 antibody; OTT3 antibody; Putative RNA binding protein 15B antibody; Putative RNA-binding protein 15B antibody; RB15B_HUMAN antibody	WB	Human, Mouse, Rat
	RBM15B Antibody (YA7061) is a Mouse-derived and non-conjugated IgG1 monoclonal antibody, targeting to RBM15B.

HY-P83061

	CUG BP1 Antibody (YA2806) CELF1; BRUNOL2; CUGBP; CUGBP1; NAB50; CUGBP Elav-like family member 1; CELF-1; 50 kDa nuclear polyadenylated RNA-binding protein; Bruno-like protein 2; CUG triplet repeat RNA-binding protein 1; CUG-BP1; CUG-BP- and ETR-3-like factor 1; Dead	WB, IHC-P, ICC/IF, FC, IP	Human, Mouse, Rat
	CUG BP1 Antibody (YA2806) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to CUG BP1.

HY-P83284

	hnRNP G Antibody (YA3029) RBMX; HNRPG; RBMXP1; RNA-binding motif protein; X chromosome; Glycoprotein p43; Heterogeneous nuclear ribonucleoprotein G; hnRNP G	WB, IHC-F, IHC-P, ICC/IF	Human
	hnRNP G Antibody (YA3029) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to hnRNP G.

HY-P86276

	TAF1C Antibody (YA5968) TAF1C; TATA box-binding protein-associated factor RNA polymerase I subunit C ; RNA polymerase I-specific TBP-associated factor 110 kDa; TAFI110; TATA box-binding protein-associated factor 1C; TBP-associated factor 1C; Transcription initiation factor SL1/TIF-IB subunit C;	WB, IP	Human
	TAF1C Antibody (YA5968) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to TAF1C.

HY-P85441

	LRRFIP1 Antibody (YA5133) LRRFIP1; GCF2; TRIP; Leucine-rich repeat flightless-interacting protein 1; LRR FLII-interacting protein 1; GC-binding factor 2; TAR RNA-interacting protein	WB	Human
	LRRFIP1 Antibody (YA5133) is a Mouse-derived and non-conjugated monoclonal antibody, targeting to LRRFIP1.

HY-P83284A

	hnRNP G Antibody (YA3029)(PBS only) RBMX; HNRPG; RBMXP1; RNA-binding motif protein; X chromosome; Glycoprotein p43; Heterogeneous nuclear ribonucleoprotein G; hnRNP G	WB, IHC-F, IHC-P, ICC/IF	Human
	hnRNP G Antibody (YA3029) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to hnRNP G.

HY-P83592

	DAZL Antibody (YA3337) DAZ homolog; DAZ like autosomal; DAZH; DAZL; DAZL1; DAZLA; Deleted in azoospermia like 1; Germline specific RNA binding protein; SPGY like autosomal; SPGYLA; Tpx2	WB	Human
	DAZL Antibody (YA3337) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to DAZL.

HY-P85550

	LRRFIP1 Antibody (YA5242) FLAP1; FLIIAP 1; GC binding factor 2; GCF2; HUFI1; Leucine rich repeat; in FLII; interacting protein 1; Leucine rich repeat flightless interacting protein 1; LRR FLII interacting protein 1; LRRFIP 1; Lrrfip1; MGC10947; MGC119738; MGC119739; NEDD8 conjugating enzyme; TAR RNA interacting protein; TAR RNA-interacting protein; Transcription factor 9 like; TRIP.	WB	Human, Mouse
	LRRFIP1 Antibody (YA5242) is a Mouse-derived and non-conjugated monoclonal antibody, targeting to LRRFIP1.

HY-P85872

	MED1 Antibody (YA5564) Mediator of RNA polymerase II transcription subunit 1; Activator-recruited cofactor 205 kDa component; ARC205; Mediator complex subunit 1; Peroxisome proliferator-activated receptor-binding protein; PBP; PPAR-binding protein; Thyroid hormone receptor-associated protein complex 220 kDa component; Trap220; Thyroid receptor-interacting protein 2; TR-interacting protein 2; TRIP-2; Vitamin D receptor-interacting protein complex component DRIP205;	WB, ICC/IF, ELISA	Human
	MED1 Antibody (YA5564) is a Mouse-derived and non-conjugated IgG1 monoclonal antibody, targeting to MED1.

HY-P82159

	ILF3 Antibody (YA1904) ILF3; DRBF; MPHOSPH4; NF90; Interleukin enhancer-binding factor 3; Double-stranded RNA-binding protein 76; DRBP76; M-phase phosphoprotein 4; MPP4; Nuclear factor associated with dsRNA; NFAR; Nuclear factor of activated T-cells 90 kDa; NF-AT-90; Translational control protein 80; TCP80	WB, IHC-P, ICC/IF, IP, FC	Human, Mouse
	ILF3 Antibody (YA1904) is a Rabbit-derived and non-conjugated IgG monoclonal antibody, targeting to ILF3.

HY-P810468

	MBNL1 Antibody (YA9767) Muscleblind Like Splicing Regulator 1, EXP, KIAA0428, MBNL, Triplet-Expansion RNA-binding protein, Muscleblind-Like protein 1, EXP42, EXP40, EXP35, Muscleblind-Like Splicing Regulator 1, Muscleblind (Drosophila)-Like, Muscleblind-Like (Drosophila), Muscleblind-Like	WB FC ICC/IF	Human, mouse
	MBNL1 Antibody (YA9767) is a Rabbit-derived and non-conjugated IgG Monoclonal, Recombinant antibody, targeting to MBNL1.

Compare Products


Products	In-stock - + Add to Cart
Cat. No.
Host
Reactivity
Application
Dilution Ratio
Molecular Weight
Conjugation
Clonality
Immunogen
Appearance
Isotype
Gene ID
SwissProt ID
Purity
Formulation
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Cat. No.	Product Name		Classification

HY-147217

Bepirovirsen ISIS 505358		Antisense Oligonucleotides
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium		Antisense Oligonucleotides
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-153845

RNA Aptamer Broccoli sodium		Aptamers
RNA Aptamer Broccoli sodium is a 49-nucleotide nucleic acid aptamer that is much shorter than Spinach and Spinach2. It exhibits bright green fluorescence when binding to DFHBI or DFHBI-1T (a soluble analog of the green fluorescent protein label). RNA Aptamer Broccoli sodium can be used for RNA expression or localization in living cells .

HY-113225

Guanosine triphosphate GTP		Nucleotide Analogs
Guanosine triphosphate (GTP) is a critical nucleotide and regulator of cellular metabolism. Guanosine triphosphate promotes ribosomal DNA localization, pre-rRNA transcription and ribosome biogenesis by binding to RNA polymerase I and GPN proteins (GPN1/3). Guanosine triphosphate links MYC-dependent ribosome biogenesis to nucleotide sufficiency, acts as a metabolic gatekeeper supporting protein synthesis, DNA/RNA synthesis and cellular signal transduction, while also participating in the physiological activities of pancreatic β-cells and serving as an oxidative substrate for reactive oxygen species. In small cell lung cancer with high MYC expression, Guanosine triphosphate accumulates through the IMPDH-driven synthetic pathway, thereby affecting apoptosis and mitotic processes. Guanosine triphosphate is used in the research of small cell lung cancer, hepatoblastoma and cellular metabolism .

HY-153235

COVID-19 Spike Protein mRNA-LNP		mRNA Liposome Antigens
COVID-19 Spike Protein mRNA-LNP is a lipid nanoparticle (LNP) containing mRNA encoding COVID-19 Spike Protein. COVID-19 Spike Protein undertakes the functions of virus binding with host cell receptors, thereby mediating the entry of COVID-19 virus into cells. COVID-19 Spike Protein is an important site of action for host neutralizing antibodies and a key target for vaccine design. COVID-19 Spike Protein mRNA-LNP can be used for RNA delivery, vaccine formulation and design targeting SARS-CoV-2 .

HY-153843

RNA Aptamer Corn sodium		Aptamers
RNA Aptamer Corn (sodium) is a 28-nt-long aptamer that is substantially shorter than Spinach and Spinach2 and exhibits bright red fluorescence upon binding DFHO (a soluble analog of the intrinsic fluorophore of red fluorescent protein), RNA Aptamer Corn (sodium) can be used to visualize RNA expression or localization in live cells which have been soaked with chromophores. The Corn-DFHO does not become appreciably cytotoxic when illuminated. And most importantly, Corn-DFHO exhibits markedly increased photostability compared to other aptamer-chromophore complexes both in vitro and in vivo. (36 nt Corn construct: 5'-GGCGCGAGGAAGGAGGUCUGAGGAGGUCACUGCGCC-3'; A 36-nt RNA construct, comprised of the 28-nt minimal Corn sequence extended proximally with a 4 base-pair stem.)

HY-139098

7-Methyl-diguanosine triphosphate m7Gp3G		Cap Analogs
7-Methyl-diguanosine triphosphate (m7Gp3G) is an mRNA cap structure analog that inhibits in vitro protein synthesis by binding to the translation initiation complex. 7-Methyl-diguanosine triphosphate binds to eIF4E, promotes cap-dependent translation initiation, stabilizes mRNA, and acts as a translation enhancer. 7-Methyl-diguanosine triphosphate can be used to prepare synthetic capped RNA transcripts for studies related to mRNA translation, splicing, turnover, and intracellular transport .

HY-174590

Human LIN28A mRNA		mRNA Transcription Factors
Human Lin-28 homolog A (LIN28A) mRNA encodes a LIN-28 family RNA-binding protein that acts as a posttranscriptional regulator of genes involved in developmental timing and self-renewal in embryonic stem cells. LIN28A functions through direct interaction with target mRNAs and by disrupting the maturation of certain miRNAs involved in embryonic development.

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

RNA binding protein

Inhibitors & Agonists

Screening Libraries

Biochemical Assay Reagents

Peptides

NaturalProducts

Recombinant Proteins

Isotope-Labeled Compounds

Antibodies

Oligonucleotides

Natural
Products